Marys Medicine

Light promotes regeneration and functional recovery and alters the immune response after spinal cord injury

Lasers in Surgery and Medicine 36:171–185 (2005) Light Promotes Regeneration and Functional Recoveryand Alters the Immune Response After Spinal Cord Injury{ Kimberly R. Byrnes, PhD,1* Ronald W. Waynant, PhD,2 Ilko K. Ilev, PhD,2 Xingjia Wu, BS,1 Lauren Barna, BS,1Kimberly Smith,1 Reed Heckert, BS,1 Heather Gerst, BS,1 and Juanita J. Anders, PhD 1Department of Anatomy, Physiology & Genetics, Uniformed Services University of the Health Sciences,Bethesda, Maryland 208142Center for Devices and Radiological Health, ElectroOptics Branch, Food and Drug Administration, HFZ-134,Rockville, Maryland 20857 tion in recovery is attributed to a light absorption (PBM) has been proposed as a potential therapy for spinal mechanism [30] rather than through the production of cord injury (SCI). We aimed to demonstrate that 810 nm heat [29,31,32]. Research has shown that dosages of 0.001– light can penetrate deep into the body and promote 10 J/cm2 stimulate cellular activity (such as DNA, RNA, neuronal regeneration and functional recovery.
and protein production, proliferation, and motility) while Study Design/Materials and Methods: Adult rats dosages greater than 10 J/cm2 inhibit activity [33].
underwent a T9 dorsal hemisection, followed by treatment Following SCI, high dosage PBM in combination with with an 810 nm, 150 mW diode laser (dosage ¼ 1,589 J/cm2).
transplantation resulted in an increase in axonal sprout- Axonal regeneration and functional recovery were assessed ing, decreased scar formation, and improved weight bear- using single and double label tract tracing and various ing and step taking in dogs and rats in comparison to locomotor tasks. The immune response within the spinal transplantation alone [34–36]. These studies indicate that cord was also assessed.
PBM may have a number of therapeutic effects following Results: PBM, with 6% power penetration to the spinal SCI, potentially by decreasing the inflammatory response cord depth, significantly increased axonal number and dis- at the spinal cord lesion site.
tance of regrowth (P < 0.001). PBM also returned aspects Invasion/activation of immune cells has been under of function to baseline levels and significantly sup- investigation as a potential mediator of secondary injury pressed immune cell activation and cytokine/chemokine [23]. A variety of cell types invade or are activated within the first hours to days after SCI, including neutrophils, Conclusion: Our results demonstrate that light, deliver- macrophages, microglia, astrocytes, and T and B lympho- ed transcutaneously, improves recovery after injury and cytes [25,37–46]. These cells are primarily activated or suggests that light will be a useful treatment for human drawn into the lesion area by pro-inflammatory cytokines SCI. Lasers Surg. Med. 36:171–185, 2005.
and chemokines, expressed within the first few hours after ß 2005 Wiley-Liss, Inc.
injury [42,47–49]. Recent evidence suggests that alterationof cell invasion/activation after SCI improves functional Key words: astrocytes; corticospinal tract; footprint recovery. Research demonstrated that depletion of macro- analysis; low power laser irradiation; macrophage; micro- phages improved locomotion, spared white matter, pre- glia; photobiomodulation; rat; retrograde and anterograde served myelinated axons, supported axonal sprouting and reduced cavitation [50]. Anti-inflammatory drugs alsoincreased tissue sparing [51] and promoted functional re- covery [21,52].
Damaged central nervous system axons fail to regenerate To date, no study has assessed the axonal regrowth of following spinal cord injury (SCI) in adult mammals.
specific tracts or the recovery of specific locomotor functions Despite vigorous research, including use of anti-inflamma-tory drugs [1], X-irradiation [2,3], elimination of inhibitory Contract grant sponsor: Defense Veterans Head Injury Pro- gram; Contract grant sponsor: Defense Advanced Research factors in the spinal cord [4–9], provision of neurotrophic Projects Agency.
factors [10–14], and cell transplantation [15–22], there {This article is a US government work and, as such, is in the currently is no cure for the sensory or motor deficits seen public domain in the United States of America.
J. J. A. has disclosed a potential financial conflict of interest following injury. After SCI, a secondary injury occurs that with this study.
is mediated in part by the immune response [23] and *Correspondence to: Kimberly R. Byrnes, PhD, Department of magnifies the impairment [23–25].
Neuroscience, Room EP16A, Georgetown University, 3970 Reser-voir Rd, NW, Washington, DC 20057.
Photobiomodulation (PBM), also known as light therapy, low power laser irradiation, or low level laser irradiation, is Accepted 21 December 2004Published online 9 February 2005 in Wiley InterScience an effective treatment for cutaneous wounds and promot- ing peripheral nerve regeneration [26–29]. This modula- DOI 10.1002/lsm.20143 ß 2005 Wiley-Liss, Inc.
BYRNES ET AL.
in the spinal cord after acute injury and PBM. Additional- St. Louis, MO) was injected bilaterally at 0.5 mm lateral to ly, no study has investigated the mechanisms of light the midline into the gray matter (0.5 ml into each side) of the therapy's effect within the injured nervous system. Here, spinal cord at a depth of 1.3 mm [54,55]. This injection we show that light applied transcutaneously at the site of would result in the spread of the dye to label axonal SCI is able to penetrate to the level of the spinal cord and terminations in Rexed's laminae 7–9.
significantly improves axonal regeneration and restoresspecific locomotor functions while altering the immune Anterograde Labeling response after injury.
Five weeks after CST lesion, 5% tetramethylrhodamine biotinylated dextran (mini-ruby, Molecular Probes) was MATERIALS AND METHODS injected into the motor cortex of one group of 10 rats using stereotaxic coordinates (n ¼ 5/experimental group). Theskin overlying the skull was shaved and swabbed with Eighty-five adult female Sprague–Dawley rats (200– alcohol pads. A midline incision was made in the skull and 300 g, Taconic Farms, Germantown, NY) were used in this a total of six holes were drilled through the skull at study under an approved Uniformed Services University the following stereotaxic coordinates to ensure that the IACUC protocol. Food and water were provided ad libitum axonal tracer was injected into the primary motor cortex: and the rats were exposed to 12 hour reversed cycles of light from bregma, 0.11 AP and  1.60 ML; 1.33 AP and and dark periods. For all experimental procedures, rats  1.50 ML; 2.85 AP and  1.40 ML. The needle of a were anesthetized with sodium pentobarbital (50 mg/kg, Hamilton syringe was placed in each hole at a depth of 1.0– i.p.) and placed on isothermal heating pads warmed to 1.2 mm. Two microliters of the mini-ruby solution were injected into the primary motor cortex through each hole, Spectrophotometric and Power Measurement for a total injection of 12 ml into the primary motor cortex.
The skull was covered with bone wax, and the skin was An incoherent broadband white light was directed at the surface of the skin in the low thoracic vertebral levelof adult, Sprague–Dawley rats (n ¼ 5). A smart, tissue- activated optical fiber probe [53] was inserted sequentially Beginning within 15 minutes after spinal cord dorsal into the skin (layer 1; 1 mm thick), sub-cutaneous con- hemisection, rats randomly assigned to the PBM group nective tissue layer (2; 1 mm thick), deep connective were transcutaneously irradiated at the lesion site. Irra- tissue layer (3; 1 mm thick), muscle (4; 15 mm thick), diation was applied daily for 14 consecutive days with a and the spinal cord within the vertebral column (5; 10 mm continuous wave 810 nm diode laser (Thor International, thick). At each of these layers, a transmission spectrum in UK; 200 mW output, modified and homogenized with a the range of 500–1,200 nm was collected while white light delivery optical fiber resulting in an output power of was applied to the skin surface.
150 mW, 2,997 seconds treatment time/day). The dosageapplied to the surface of the skin was 1,589 J/cm2 per day Corticospinal Tract (CST) Lesion (dose ¼ [energytime]/treatment area; 0.53 W/cm2, 450 J).
Rats were randomly assigned to control (n ¼ 40) or PBM This is the dosage found to improve functional recovery (PBM; n ¼ 40) groups. Dorsal hemisection was performed by after injury in previous studies [35]. During treatment, the an investigator blinded to group assignment. A laminect- 0.3 cm2 spot was centered on the skin directly above the omy followed by a dorsal hemisection was performed at location of the spinal cord hemisection, with the expectation vertebral level T9 by passing a 6-0 suture (Nurulon; that the spot size would spread as it progressed through the Ethicon, Inc., Piscataway, NJ) beneath the dorsal funiculus tissue, while maintaining enough power to reach the spinal and carefully incising the entire dorsal portion of the spinal cord, as is presented in our accompanying paper. Power cord with iridectomy scissors. This lesion results in output of the light source was measured with a power transection of the CST, which lies in the base of the dorsal meter to ensure that power delivery was consistent (Ultima funiculus. Complete transection was assured by lifting the Labmaster, Coherent, Inc., Auburn, CA). Prior to treat- suture through the lesion. Inspection of the lesion and ment, all animals were lightly anesthetized with sodium visualization of the central gray commissure verified that pentobarbital (20 mg/kg, i.p.) and placed on isothermal the CST had been transected.
heating pads. All treatments were done in the dark. Rats inthe control group were handled identically, except they did Retrograde Labeling not receive light treatment. Using these treatment para- At the time of CST lesion, gelfoam soaked in hydro- meters, no adverse effects were noted at the skin surface at xystilbamidine methanesulfonate (HM, also known as any time during or after treatment (data not shown).
fluorogold; 3% in 0.9% saline; Molecular Probes, Eugene, Previous studies in our laboratory have determined that OR) was inserted into the lesion site of 20 rats (n ¼ 10/ this level of irradiation does not induce significant heating experimental group). Ten weeks after the surgery, a at the level of the spinal cord, with an average temperature laminectomy was performed approximately 24 mm caudal increase of 0.350  0.018C over the entire treatment time to the original lesion site (vertebral level L3). The dura was (data not shown). At the skin surface, the average tem- incised and 1 ml of a 2% fast blue solution (in PBS, Sigma, perature increase is 1.832  0.068C (data not shown). Other LIGHT PROMOTES REGENERATION AND FUNCTIONAL RECOVERY investigators have determined that heating in this range section thickness). Neuronal count data were analyzed does not have the same effect as light treatment, suggesting using Mann–Whitney U-analysis.
that the effects observed are due to light interaction rather Only tissue in which cortical and spinal cord injection than heating [31,32].
sites were without leakage of the tracer large distancesaway from the injection site and with adequate uptake into Labeling Assessment the intended neurons were included in the final analysis.
Rats were intracardially perfused with 4% paraformal- dehyde 8 days after injection of mini-ruby or fast blue. Work Functional Testing in our laboratory had determined that 8 days was a suf- One week prior, and 1 and 9 weeks after dorsal hemi- ficient time for mini-ruby labeling of the thoracic spinal section, the same rats undergoing retrograde labeling cord from the motor cortex (data not shown). Previous (n ¼ 10/experimental group) were trained for 3 days and studies [56–58] have shown that 8 days is also sufficient for then tested for 2 days (five trials per day) to walk across a fast blue labeling of the cortex. Coronal sections of the brain ladder beam (Columbus Instruments, Columbus, OH) that through the motor cortex, 20 mm thick, and longitudinal recorded the crossing time and footfalls. Footfalls were sections of spinal cords, including 3 mm rostral to and assessed as the number of time paws failed to grasp a ladder 16 mm caudal to the lesion, were collected. These 20 mm rung and fell below the plane of the ladder. Crossing time thick sections were collected from the dorsal aspect of the was assessed as the amount of time in seconds required to spinal cord through the level of the gray commissure.
cross the ladder and reach a dark box at the end. This test Mini-ruby labeled spinal cord sections, including the was videotaped for confirmation. Rats also underwent foot- lesion site and 16 mm caudal, were collected at a ratio of 1/6.
print analysis and base of support (distance between Mini-ruby labeled axons were counted at 0.5 mm intervals central pads of the hind paws), stride length (distance from the lesion site through 16 mm caudal to the lesion between the central pads of two consecutive prints) and using an RITC filter (excitation 528–553 nm) and 20 angle of rotation (angle formed by the intersection of the magnification, as described previously [21]. Total axons line through the print of the third digit and the line through counted were then averaged/section and, as the total the central pad parallel to the walking direction) were number of sections required to encompass the entire CST analyzed in a method modified from that of Metz et al. [61].
was found to be 24, the average was multiplied by 24 for a Briefly, hind paws of rats were inked and rats were allowed final average axon count/animal. Axon counts were com- to walk across a narrow runway covered in white paper to a pared at 1 mm intervals for statistical analysis, and safety cage. All testing was done in triplicate on two con- average distance of regeneration was established for each secutive days, and testing at nine weeks was completed animal in each group. Axonal counts are presented as prior to administration of the second retrograde tracer to mean  SEM. Axonal count data were analyzed using one- avoid complications from a second surgery. Data are pre- way ANOVA, with Bonferroni post-test.
sented as mean percentage of pre-surgical measurement For neuronal counting, cortical sections were collected to control for variations among animals. Functional data and mounted at a ratio of 1/8. The fractionator method of were analyzed using Repeated Measures ANOVA with unbiased stereology [59] was used to count HM and/or fast Newman–Keuls post-test to assess changes over time or blue labeled neurons in the motor cortex at a magnifica- one-way ANOVA with Tukey post-test to assess differences tion of 20 (2.6 mm from midline to lateral edge of brain between groups at individual time points.
per hemisphere). Every eighth section from Bregma toBregma—2.5 mm was assessed using a random start site.
Two filters, with excitation ranges of 330–380 nm and 450– Spinal cord tissue from rats was collected at 48 hours, 490 nm, were used to identify single (HM or fast blue) and 14 and 16 days post-injury (DPI). At each time point, five double labeled neurons. Double labeling was described as rats per experimental group were deeply anesthetized with those neurons with a blue cytoplasm with green punctate 10% chloral hydrate (1 ml/100 g, i.p.) and euthanized via labeling in the cytoplasm, as reported previously [60]. The intracardiac perfusion with 4% paraformaldehyde. The percentage of neurons that regenerated an axon was calcu- thoracic spinal cord at the lesion site, which was typically lated according to the following calculation: approximately 2 mm long and was identifiable by visiblescar tissue, and 3 mm rostral and 5 mm caudal to the lesion Double labeled neurons site was dissected, post-fixed for 24 hours in 4% parafor- Fast Blue þ HM þ Double labeled neurons maldehyde, and cryoprotected for 24 hours in 30% sucrose.
Neuronal counts are presented as mean percentage Twenty micrometer longitudinal sections were collected of total neuronal number counted  SEM. This calcu- from the dorsal aspect of the spinal cord through the level of lation was based on an unbiased stereological technique the gray commissure. Sections were serially mounted onto that uses a dissector method and extrapolates the total 10 slides, with three sections per slide. One slide from each number of objects from a representative sample of the rat was processed for each cell type under investigation.
whole. The total number of objects ¼ the sum of the objects Immunolabeling was repeated for each animal to ensure counted1/(the number of sections sampled/total number labeling efficacy. Negative controls, in which primary anti- of sections)1/(the total area sampled/total area on all body was not added during immunohistochemistry, were sampled sections)1/(the height of the dissector/total run for each cell type. The tissue was rehydrated and BYRNES ET AL.
blocked with an appropriate blocking solution. Tissue was the Scion Image program and normalized against the incubated overnight with primary antibodies for macro- endogenous control, glyceraldehyde-3-phosphate dehydro- phages/activated microglia (ED1, 1:175, Serotec, Inc., genase (GAPDH). All data is presented as the ratio of gene of Raleigh, NC), neutrophils (RP3, 1:30, BD Pharmingen, interest to GAPDH  SEM. Resultant relative gene expres- San Diego, CA), T lymphocytes (UCHL1, 1:25, Dako Corp, sion is presented as mean ratio  SEM. One-way ANOVA Carpinteria, CA), B lymphocytes (L26, 1:75, Dako Corp), was used to compare groups, with Tukey's post-test for Schwann Cells (S100, 1:100, Santa Cruz, Santa Cruz, comparison of individual groups.
CA), or astrocytes (GFAP, 1:100, Dako Corp) followedby incubation with an appropriate fluorescently labeled Statistical Analysis secondary antibody (Jackson Immunochemicals, West All statistical tests were performed using the GraphPad Grove, PA) at room temperature for 30 minutes.
Prism Program, Version 3.02 for Windows (GraphPad The lesion epicenter and adjacent 1 mm of tissue of at Software, Inc., San Diego, CA) and SPSS 11.0 for Windows least six sections per animal per antibody were digitally (SPSS, Inc., Chicago, Illinois).
photographed using a Leica/Spot system (Version 2.2 forWindows, Diagnostic Instruments, Inc., Sterling Heights,MI). The proportional area of tissue occupied by immuno- histochemically stained cellular profiles within a defined Light Penetrates to the Spinal Cord target area (the lesion site and surrounding tissue) was Ex and in vivo spectrophotometric and power transmis- measured using the Scion Image Analysis system (http:// sion analyses were performed to assess the extent to which rsb.info.nih.gov/nih-image/) using a method modified from transcutaneous 810 nm laser light, with an output power that described by Popovich et al. [46]. Briefly, tissue regions of 150 mW, penetrates to the depth of the spinal cord were scanned and the proportion of the area that included (Fig. 1a,b). Analysis of the transmission spectra revealed positive immunolabeling was measured. All tissue sections the range of transmission, or penetration, was highest were coded prior to measurement to prevent bias and all through all tissue layers overlying the spinal cord (Fig. 1c) image backgrounds were normalized prior to quantitation.
and through blood (Fig. 1d) between the 770 and 850 nm Area of spinal cord occupied by cell type is expressed as wavelengths. The transmission of light through tissue is mean  SEM. Kruskal–Wallis statistical analysis with heavily influenced by the absorption of light by blood Dunn's post-test was used to compare means. Student's (Fig. 1d), which is reflected by the similarity between the t-test was also used for detection of differences at individual two peaks of transmission as well as the relatively flat time points.
transmission spectra by skin (Fig. 1c, layer 1). Analysis of power penetration revealed that 6% of the power of a150 mW 810 nm laser was transmitted through all of the At 6 hours or 4 DPI, five rats/time point/group were layers of tissue between the dorsal skin surface and the deeply anesthetized and euthanized by decapitation. The ventral side of the spinal cord. These data show that 810 nm 5 mm of the spinal cord encompassing the lesion site and light is within the optimal range for light penetration to the the area immediately rostral and caudal was dissected and spinal cord level if applied transcutaneously, and that 9 mW placed in 500 ml of RNAlater solution (Amnion, Austin, TX).
of energy will reach the spinal cord if the initial output is Total cellular RNA was extracted and reverse transcribed using First-Strand Synthesis beads (Marsha Pharmacia,Piscataway, NJ) as per the protocol of the manufactu-rers (Nitrogen, Carlsbad, CA and Amersham Pharmacia).
Light Improves Axonal Regrowth Briefly, tissue was homogenized in TRIzol (Invitrogen) To determine if application of 810 nm light to the injured using a FastPrep machine (Qbiogene, Carlsbad, CA). RNA spinal cord increased axonal growth, an anterograde was then extracted using the chloroform/isopropanol tracer, mini-ruby, was injected bilaterally into the motor method and purified with a 75% ethanol wash prior to cortex 5 weeks after a CST lesion. Analysis revealed that being resuspended. RNA was transferred to tubes contain- mini-ruby labeled axons were found in the white matter, in ing First-Strand Synthesis beads (Amersham Pharmacia) the region of the spinal cord normally occupied by the CST and Random Hexamers (Invitrogen) and incubated at (i.e., in the dorsal funiculus, between the dorsal horns; 1 hour at 378C. Resultant cDNA was amplified using the Fig. 2a,d,e). These axons were observed to pass the lesion CytoXpress Multiplex Inflammatory Set 1 (Biosource, site ventral, dorsal or around the remaining cavity (Fig. 2a), Camarillo, CA) or monocyte chemoattractant protein–1 or to traverse the lesion through a tissue bridge (Fig. 2b), (MCP-1; 50 CTTCTGGGCCTGTTGTTCAC 30; 50 GGGAC- as has been reported previously [64–67]. There were few GCCTGCTGCTGGTGATTC 30), macrophage inflamma- mini-ruby labeled axons caudal to the lesion in the control tory protein 1a (MIP1a; 50 TTTTGAGACCAGCAGCCTTT group (Fig. 2c,g), with 16.32  8.53 found at 1 mm, 30; 50 CTCAAGCCCCTGCTCTACAC 30), or inducible nitric 8.61  5.76 at 4 mm, and 0 axons found from 7 to 16 mm oxide synthase (iNOS; 50 CCCTTCCGAAGTTTCTGGCAG- caudal to the lesion (Fig. 2g). These labeled axons were CAGC 30; 50 GGGTGTCAGAGTCTTGTGCCTTTGG 30).
calculated to extend an average distance of 2.9  0.8 mm PCR products were quantified as previously described caudal to the lesion (Fig. 2f), which is comparable to pre- [62,63]. Briefly, pixel density for each band was measured viously reported spontaneous post-lesional sprouting [68].


LIGHT PROMOTES REGENERATION AND FUNCTIONAL RECOVERY labeled axons were only found at these distances in thePBM group. The mini-ruby labeled axons in the PBM groupextended an average of 8.7  0.8 mm caudal to the lesion,a significantly increased length over the control group(P < 0.05; Fig. 2f).
Anterograde analysis demonstrates the presence of axons caudal to a transection; however, to determine if PBMpromotes regeneration of transected axons, a double label,retrograde tracing analysis was performed. Based on theanterograde tracing data, axons in the PBM group werecalculated to grow at a rate of 0.25–0.4 mm per day. Thus,axons would require approximately 10 weeks to reach themid-lumbar region and innervate interneurons or motorneurons responsible for lower limb function [69]. At thetime of CST lesion, transected neurons were labeled byinserting HM into the lesion. Ten weeks after CST lesion,axons terminating at vertebral level L3, approximately24 mm caudal to the initial lesion, were labeled by injectingfast blue into the ventral horn. Numbers of single (HM orfast blue) and double (HM and fast blue; neurons withaxons that were transected and regrew to L3) labeledneurons in the motor cortex were assessed using unbiasedstereology. Due to insufficient labeling in two animals andthe deaths of two animals prior to tract tracing analysis, alldata presented for double-labeling assessment is for an n of7 in the control group and an n of 9 in the PBM group.
Analysis of single labeled neurons (HM or fast blue) revealed no significant difference (P > 0.05) between con-trol and PBM groups, demonstrating no difference in label-ing efficacy between groups (Fig. 3a,b,c). The averagenumber of HM labeled neurons is 8,860  3,408 in thecontrol group and 13,270  3,236 in the PBM group, whichis comparable to the number of CST axons reported in thelower thoracic region of the spinal cord [70,71]. The aver-age number of fast blue labeled neurons is 129  109 inthe control group and 131  120 in the PBM group, which iscomparable to the number of neurons found in the motor Fig. 1. Light penetration analysis. a: Photograph of spectro- cortex after injection of a retrograde tracer into the ventral photometric analysis experimental set-up. The smart fiber portion of the CST at vertebral level L4 [70]. Since fibers of (arrow) is inserted below the skin of the rat, the light source the dorsal and ventral CST originate from the same area (arrowhead) is positioned above the skin for transcutaneous of the motor cortex [70] and the lesioning procedure used application of light. b: Ex vivo power analysis, a cross section of in this study transects the dorsal CST but not the ventral the rat's dorsal thoracic region was placed between the light CST, it is likely that these fast blue labeled neurons are source and a power meter. Graphical representation of from the unlesioned ventral CST.
transmission (in arbitrary units) through each layer of tissue Double labeled neurons, with both HM and fast blue (c) or through blood (d), depending on wavelength (nm). Layer labeling, were found only in the PBM group (Fig. 3d,e,f). In 1, skin; 2, loose connective tissue; 3, dense connective tissue; the PBM group, a maximal number of 543 double labeled 4, muscle; 5, vertebral column and spinal cord.
neurons were counted, with an average of 70.5  59.6 forthe entire group. The percentage of double labeled neuronsrepresented a statistically significant increase in compar-ison to the control group (P < 0.05; Fig. 3d). This increasein double labeling indicates that only CST axons in the Analysis of axonal number from 1 to 16 mm caudal to the PBM group regrew and terminated in the gray matter of lesion revealed that there were significantly more mini- vertebral level L3 after transection.
ruby labeled axons in the PBM group than the control group(P Light Improves Locomotor Function < 0.05; Fig. 2g), with an average axonal count ranging from 71.76  17.7 to 120.7  18.5 axons counted per mm. No To determine if PBM resulted in functional improve- significant difference was found between the groups from ment, performance of rats in two functional tests, 10 to 16 mm caudal to the lesion, although mini-ruby the ladder/grid walking test and footprint analysis, was


BYRNES ET AL.
Fig. 2. Mini-ruby labeled axons and related quantitation at funiculus white matter (wm) between the dorsal horn gray 5 weeks post-injury. Photomicrograph of two lesion sites (a, b), matter (gm), indicated with arrows, are found at this distance with axons passing around (a) or through (b) the lesion site only in the PBM group. Bar ¼ 23 mm (c, e); 11.8 mm (a, b, d).
(arrows). Photomicrograph of white matter 4 mm caudal to the Comparisons of average axon number/animal (f) and average lesion site in control rat (c) and photobiomodulation (PBM) rat distance caudal to the lesion (g) are shown. *P < 0.05, (d, e). Note that mini-ruby labeled axons in the dorsal **P < 0.001. N ¼ 5/group. Bars represent mean  SEM.
assessed prior to and after CST lesion. Five measurements There was a significant increase in footfalls in both control were taken, including footfalls, time to cross the ladder, and PBM animals post-surgery (P < 0.05; Fig. 4b), but no base of support, stride length, and angle of rotation.
significant difference between these two groups. No signi- One week after CST lesion, rats had significant impair- ficant change was found in stride length or base of support ments in angle of rotation (P < 0.05; Fig. 4a) in the control in either group at any time point after CST lesion (P > 0.05).
group and footfalls (P < 0.05; Fig. 4b) in the control and These functions have been found to be under the control of PBM groups in comparison to pre-surgical measurements.
tracts other than CST, and are not normally affected by An increase in ladder cross time was also observed in both CST lesion alone [11], confirming the specificity of this groups at this time point (Fig. 4c). However, there was lesion model for the CST.
no significant difference between pre- and post-surgicalangle of rotation in the PBM group at 1 week post-injury Light Alters the Immune Response (P > 0.05; Fig. 4a).
To explore the potential mechanism of PBM's effects after At 9 weeks post-injury, angle of rotation remained at the SCI, the immune response within the spinal cord was baseline level (P > 0.05; Fig. 4a,d) and ladder beam cross assessed. Immunolabeling was quantified in order to deter- time had returned to pre-surgical values (P > 0.05; Fig. 4c) mine the invasion/activation of different cell types in the in PBM animals, demonstrating a recovery of these func- spinal cord at 48 hours, 14 and 16 days after SCI.
tions. Control animals had measurements that remained at Due to the clustering of cells surrounding the lesion elevated levels (P < 0.05; Fig. 4a,c,d). Comparison of these following SCI, assessment of numbers of individual cells measurements in PBM and control groups revealed a signi- was not possible. Therefore, measurement of tissue area ficant improvement in the PBM group (P < 0.05; Fig. 4a,c).
occupied by immuno-positive label within a defined target


Fig. 3. Single and double labeled neurons at 10 weeks post- *P < 0.05; Mann–Whitney U. Bar represents mean percentage injury. HM labeled neurons in motor cortex (a, arrowheads), of counted neurons  SEM. e–g: Double labeled neurons fast blue labeled neurons at L3 injection site (b), and fast blue (arrows), found only in motor cortex of PBM rats. Bar ¼ 134 mm labeled neurons in motor cortex (c). d: Graphical representa- (a); 67 mm (b, f, g); 45 mm (c); 89 mm (e).
tion of double labeled neurons in PBM and control groups.


BYRNES ET AL.
space (i.e., within the lesion and adjacent tissue area) wasused to assess cell invasion/activation. As an increase inimmunolabeling does not necessarily reflect an increase incell number, this measurement is a method of quantifyingthe magnitude of a cellular response, both in terms ofcell invasion and activation. The current study does notattempt to distinguish between these two cellular responseparameters.
Macrophages and activated microglia are not distin- guishable from each other in the mammalian CNS sinceactivated microglia express the same cellular surfacemolecules and have the same round morphology as bloodborne macrophages [41,46]. Immunolabeling for ED1, anantibody against a macrophage/microglia lysosomal glyco-protein, revealed many of these large, amoeboid cells in theinjured spinal cord located in and around blood vessels, inthe dorsal roots, along the edges of the lesion site, within thelesion site, and infiltrating into the surrounding tissue at14 DPI and later. At many of the time points, there wereobservably fewer labeled macrophages/activated microgliain the PBM group than in the control group (Fig. 5a,b). Inboth control and PBM groups, ED1 expression was highestat 48 hours post-injury and 14 DPI. Both peaks werereduced in the PBM group, with significant reductionsin ED1 expression at 48 hours and 14 DPI in the PBMgroup (P < 0.001; Fig. 5e). No significant difference betweengroups was found at 16 DPI (P > 0.05).
Astrocytes were detected using an antibody against GFAP, an intermediate filament primarily expressed inastrocytes. At 48 hours post-injury, heavy GFAP positivelabeling was found to demarcate the lesion in all rats of thecontrol group, with GFAP positive processes throughoutthe 10 mm section in three of the five rats (Fig. 5c). PBMtissue, however, had only a light band of GFAP positivelabel near the lesion edge and along the meninges/bloodvessels in all five rats (Fig. 5d). In both groups, immuno-labeling for GFAP decreased over the remaining timeperiods (P < 0.05), although there was a slight increase(P < 0.05) in the PBM group in comparison to the controlgroup at 16 DPI.
T lymphocytes were detected in spinal cord tissue using UCHL1, an antibody against the surface glycoproteinCD45. Cells that were immuno-positive for UCHL1, weresmall, round, and found in very low numbers. T lympho- Fig. 4. Functional analysis. a: Angle of rotation, (b) footfalls,and (c) ladder beam crossing time measurements are pre-sented for pre-injury, and 1 and 9 weeks post-injury timepoints. Graph bars are mean percentage of pre-surgicalmeasurements  SEM. *P < 0.05, repeated measures ANOVAwith **P < 0.05, one way ANOVA with Tukey post-test betweencontrol and PBM group at 9 week time point. N ¼ 10/group.
d: Representative footprints from pre-injury and 9 weeks post-injury. Notice the increased angle of rotation at 9 weeks in thecontrol group. In the PBM group, the angle returns to pre-surgical values.


LIGHT PROMOTES REGENERATION AND FUNCTIONAL RECOVERY Fig. 5. Light suppresses cell invasion/activation. Immunola- green) adjacent to the lesion site (*) in PBM tissue 48 hours beling for macrophages/activated microglia at 14 DPI in post-injury. Quantitation for macrophage/activated microglia control (a) or PBM tissue (b), demonstrating cells in and (e), astrocytes (f), T lymphocytes (g), neutrophils (h), B around the lesion site. L indicates lesion site. c: Heavy GFAP lymphocytes (i), and Schwann cells (j). *P < 0.05, **P < 0.001.
labeling (Cy3, red) 5 mm caudal to the lesion site in control N ¼ 5/group. Graph bars represent mean  SEM. Bar ¼ 96 mm.
tissue at 48 hours post-injury. d: GFAP labeling (arrows, FITC, BYRNES ET AL.
cytes were restricted to the lesion edge and in the acellular matrix within the lesion cavity. Statistical analysis ofUCHL1 expression revealed that there was a peak in both Axons have the inherent ability to regrow following the control and PBM groups at 48 hours post-injury, with a injury and altering the spinal cord environment may decline in expression through 16 DPI (P < 0.05 between support this regeneration. The data from the current study 48 hour data and 16 DPI data, regardless of group, and demonstrates that 810 nm light, at a dosage of 1,589 J/cm2, between 14 day control data and 16 day data; Fig. 5g).
significantly improves axonal regrowth and functional UCHL1 expression in the PBM group was significantly improvement. Additionally, this study has shown that decreased at 14 DPI (P < 0.001).
PBM, which penetrated to the depth of the spinal cord with Three cell types investigated, neutrophils, B lympho- 6% of the incident power, induced a statistically significant cytes, and Schwann cells, were not significantly affected by suppression of immune cell invasion and pro-inflammatory PBM. Immunohistochemical labeling for neutrophils re- cytokine and chemokine gene expression.
vealed small, round, cellular profiles that were detected The current study found a significant increase in mini- bordering the lesion site or adjacent to the meninges at all ruby labeled axons (P < 0.01) and double labeled (HM and time points investigated in both control and PBM groups.
Fast Blue; P < 0.05) neurons in the PBM group after CST A non-significant increase in neutrophil immunolabeling lesion. The mini-ruby labeled axons quantified in this study was found at 16 DPI, which may be due to a reported were found only in the area of the dorsal funiculus normally suppression of neutrophil invasion and activity by sodium occupied by the CST, suggesting axonal regeneration of the pentobarbital, the anesthetic used for all treatments from appropriate tract. Pettigrew and Crutcher [74] demon- day 1 through 14 post-injury [72,73]. B lymphocytes, small, strated that despite the inhibitory molecules present in round cells near the edges of the spinal cord lesion or within white matter, neurite outgrowth is supported in directions the cavity, demonstrated 1–2 mm migration caudal to the parallel to white matter tracts and previous reports have lesion in the white matter tract at 16 DPI in the control demonstrated that treatment of the lesion site does allow group only. There was no migration observed in the PBM for long distance regeneration of tracts [2,19,21,54].
group. Also present in very low numbers were Schwann Double labeled neurons, representing those whose axons cells, identified by antibody labeling of S100, a neural were transected during the initial lesion and had regrown specific Ca2þ binding protein. These small, circular cells to vertebral level L3, were found only in the PBM group, were found at all time points investigated, primarily along with an average of 70.5 neurons counted, accounting for the edges of the lesion, without any migration rostral or approximately 0.3% of all counted neurons. While this is a caudal to the lesion. No quantitative difference was found small percentage, it was found to be significantly greater in the immunolabeling of these cell types between PBM and than the control group (P < 0.05). This small percentage control tissue at any time point (P > 0.05; Fig. 5h,i,j).
suggests a number of different interpretations, including To further clarify the effect of PBM on the injured spinal that additional therapies in combination with light therapy cord, RT-PCR was performed to quantify changes in expres- or alteration of the applied light treatment parameters will sion of genes involved in the immune response. Analysis of increase axonal regeneration. However, it should be noted gene expression at 6 hours and 4 DPI was performed and that the second tracer, fast blue, was injected into the gray compared to expression of GAPDH, which demonstrated no matter of vertebral level L3, 24 mm caudal to the lesion, and significant difference between the control and PBM groups was expected to label only those axons terminating in this (P ¼ 0.6740; Fig. 6a).
area. Greater percentages of double-labeling have been re- The expression of iNOS, transforming growth factor b ported following injection of the second tracer closer to the (TGFb), four pro-inflammatory cytokines (interleukin 1b lesion site (within 6–7 mm distal to the lesion; [55,75]). The (IL1b), tumor necrosis factor a (TNFa), interleukin 6 (IL6), current study revealed that double labeled neurons and granulocyte-macrophage colony stimulating factor accounted for approximately 30% of the number of mini- (GM-CSF)), and two chemokines (MIP1a and MCP-1) was ruby labeled axons observed at 5 weeks post-lesion in the assessed at 6 hours and 4 DPI. PBM resulted in a significant PBM group, further supporting the theory that a greater suppression (P < 0.001; Fig. 6a,b) of IL6 expression at number of neurons had regenerated but were not counted 6 hours post-injury, with a 171-fold decrease in expression with our labeling technique.
of IL6. PBM also resulted in a significant decrease in MCP-1 To date, no study has evaluated axonal regrowth of spe- at this time point (P < 0.01; Fig. 6c), in which the control cific tracts using retrograde or anterograde tracing after group had 66% greater expression of MCP-1. A fivefold PBM of SCI. A number of studies by Rochkind et al. [35,36] suppression of iNOS transcription at 6 hours post-injury found that PBM at similar dosages in combination with (P < 0.01; Fig. 6d) was found in the PBM group in com- transplantation increased axonal sprouting and axonal parison to the control group. By 4 DPI, transcription of IL6, myelination within the graft, in comparison to transplanta- MCP-1 and iNOS had significantly decreased in the control tion alone. However, the source of these axons was not de- group (P < 0.001; Fig. 6b,c,d), while the expression in the termined, nor were they found to extend beyond the graft.
PBM group remained depressed. There was no significant Despite the small percentage of regeneration found in difference between control and PBM groups in expression this study, studies have shown that functional improve- of TNFa, IL1b, GM-CSF, MIP1a, and TGFb at 6 hours post- ment can be found with very small amounts of axonal injury or 4 DPI (data not shown).
regrowth [2,21,76,77]. This is supported by the current


LIGHT PROMOTES REGENERATION AND FUNCTIONAL RECOVERY Fig. 6. Light suppresses gene expression. a: GAPDH expres- to internal control mean  SEM (n ¼ 5/group/time point). Re- sion; P > 0.05. b: IL6 expression at 6 hours and 4 days post- verse color ethidium bromide–DNA complex fluorescence for injury. c: MCP-1 expression at 6 hours and 4 days after SCI.
IL6 (e) and MCP-1 (f) from the control and PBM groups, as well d: iNOS expression at 6 hours and 4 days post-injury.
as their corresponding GAPDH band, at 6 hours post-injury.
*P < 0.001; **P < 0.01. Bars represent ratio of gene of interest study, in which functional recovery measurements, includ- (P < 0.05, ANOVA; Fig. 4b), ladder crossing time is posi- ing angle of hindlimb rotation during locomotion and tively correlated with hindlimb errors in step placement duration of time necessary to cross a ladder beam, were [79]. Analysis of errors in ladder crossing, including correct found to return to pre-injury values by at least 9 weeks post- placement of hindpaws and grasping of ladder rungs, was injury following PBM. Both of these activities are asso- not assessed and may have been modified by PBM, leading ciated with CST function and are significantly increased to this crossing time improvement.
after CST lesion [78,79]. It was unexpected that angle of Previous studies have also shown improvement in gross rotation data displayed a recovery to normal values at motor function after SCI and PBM [35,36]. These studies 1 week post-injury. It is possible that this early recovery is investigated non-specific recovery of function, such as due to local sprouting, enhanced compensation or sparing weight bearance, step taking, improvements in BBB score, of white matter induced by the PBM. Similar results and electrophysiological measurement in the musculature have been observed with anti-inflammatory treatments or of the hindlimbs, and found that PBM in combination with cell transplantations after injury, with an early return to transplantation improved functional recovery.
normal values in BBB scores and inclined plane measure- Previous studies employing anti-inflammatory treat- ments [80,81]. While there was a significant increase in ments have successfully improved axonal growth and footfalls in both control and PBM animals post-surgery return of function [1,21], and it is possible that the decrease without a significant difference between these two groups in the inflammatory response is one reason for the recovery BYRNES ET AL.
observed after SCI and PBM. Although the immuno- Interestingly, IL1b, TNFa, and MIP1a, which have histochemical and RT-PCR findings do not confirm that maximum expression at 3 hours post-injury or earlier, PBM improves axonal regeneration and functional recov- were not found to be altered by PBM at 6 hours post-injury.
ery because of its immunomodulatory actions, the results This finding suggests that either an effect of PBM on IL1b, do provide a basis for this theory.
TNFa and MIP1a was not detected by 6 hours post-injury or The current study determined that PBM significantly that PBM has a slow-acting effect within the spinal cord altered the invasion of a number of cell types that play a that takes several hours to become apparent.
substantial role after SCI. Immunolabeling for macro- The mechanism of how PBM affects gene transcription or phages/activated microglia, T lymphocytes, and astrocytes any other cellular activity is currently unknown. Research was significantly decreased post-injury; these cell types are into the transduction of light energy into cellular activity is involved in secondary damage to the spinal cord after injury ongoing and components of the electron transport chain [23]. This result expands upon Rochkind et al.'s [35,36] (ETC) of mitochondria and a variety of enzymes are under findings of decreased degeneration of peripheral and consideration as possible photon acceptors. The presence of embryonic grafts and decreased scar formation, proposed several maxima in the action spectra of cells suggests that to be due to suppression of the immune response after SCI.
more than one of these mechanisms may play a role in PBM Macrophages/activated microglia secrete cytotoxic pro- [95,96]. Several researchers have suggested that compo- teolytic enzymes and free radicals [82] and induce the nents of the ETC of mitochondria are the primary photon production of proteoglycans, which inhibit neurite growth acceptors [97–100] and it has been postulated that about [24,38]. It has been shown that reduction of the macrophage 50% of near-infrared light is absorbed by chromophores response with anti-inflammatory treatment after SCI within mitochondria, such as cytochrome c oxidase [101].
improves function and regeneration [23,24].
It has also been shown that near-infrared light reverses Neutrophil invasion was not altered by PBM in this the inhibiting effect of tetrodotoxin on cytochrome c study. However, the invasion was greater at 16 DPI than oxidase, restoring enzyme activity to control levels [102].
earlier, which was a surprising finding and may have been Additionally, light was found to induce changes in mem- due to suppression of neutrophil activity by sodium brane permeability to calcium [103] and cellular oxidation pentobarbital administration to both control and PBM rats state, potentially through light absorption by NADPH from days 1 to 14 post-injury [73]. This effect is restricted [104]. These PBM induced alterations can, potentially, lead to neutrophils alone and has not been shown to affect to changes in cellular activity levels, which, in turn, leads to macrophage/microglia responses or other immune respon- alterations in cellular processes including transcription ses. As the data in our study for macrophage/activated and translation, cell proliferation and phagocytosis. These microglia and pro-inflammatory gene expression in control alterations have been demonstrated to be dosage depen- rats is comparable to that of similar studies [42,46,62,83], dent [33], with low dosages 0.001–10 J/cm2 stimulating we do not believe the anesthetic effect on neutrophil in- cellular activity while dosages greater than 10 J/cm2 in- vasion significantly altered other aspects of this study.
hibit activity, as is the case in the current study. In this However, the finding that PBM had no effect on neutro- study, the dosage of 1,589 J/cm2 is theorized to be inhi- phil invasion is important to note. Several studies have biting inflammatory cell activity, thus, altering the extra- found that methylprednisolone (MP), currently the only cellular milieu and providing a potential mechanism for treatment available for acute SCI, fails to block neutro- improved axonal regeneration through the lesion site.
phil infiltration and activity after injury, while inhibit- Unfortunately, a reason for this dose dependency is cur- ing macrophage invasion [1,84,85]. The mechanism of rently unknown.
MP's actions is still under investigation, although several Despite the lack of a defined mechanism, several signi- studies have found that this drug has numerous effects ficant changes have been shown after PBM of the injured within the injured spinal cord. For example, administration spinal cord. These results demonstrate that PBM is a novel of MP decreases the activation of NF-kB and the resultant and non-invasive treatment for acute SCI that potentially expression of TNFa, which in turn diminishes the intensity acts through an immunomodulatory mechanism and sug- and duration of the inflammatory response [86]. While gest that light will be a useful treatment for humans.
PBM had no significant effect on TNFa mRNA production, asignificant suppression of other downstream NF-kB genes that normally peak at 6–24 hours post-injury, such as IL6and MCP-1 [42,49,52,62,87–89], was found. These genes We thank Tara Romanczyk and Amy Van Horn for are integrally involved in the immune response, and are technical assistance and Dr. Albert McManus for helpful suggested to play an important role in secondary injury advice on presentation of quantitative data. We also thank and/or the lack of regeneration after SCI [89–94]. IL6, Dr. Rosemary Borke, Dr. Howard Bryant, Dr. Sonia Doi, MCP-1 and iNOS are normally down-regulated beyond and Dr. Leslie McKinney for thorough reading and editorial 24 hours post-injury, and PBM was not found to decrease comments regarding this study. The opinions and asser- their values beyond this point any further. Previous tions contained herein are the private ones of the authors study has shown that interfering with the effects of these and are not to be construed as official or reflecting the views genes, through receptor antagonists or knockouts, decre- of the Department of Defense or the Uniformed Services ases macrophage invasion and secondary injury [91,93].
University of the Health Sciences.
LIGHT PROMOTES REGENERATION AND FUNCTIONAL RECOVERY 20. Li Y, Decherchi P, Raisman G. Transplantation of olfactory ensheathing cells into spinal cord lesions restores breathing 1. Xu J, Qu ZX, Hogan EL, Perot PL, Jr. Protective effect of and climbing. J Neurosci 2003;23(3):727–731.
methylprednisolone on vascular injury in rat spinal cord 21. Nash HH, Borke RC, Anders JJ. Ensheathing cells and injury. J Neurotrauma 1992;9(3):245–253.
methylprednisolone promote axonal regeneration and func- 2. Kalderon N, Fuks Z. Structural recovery in lesioned adult tional recovery in the lesioned adult rat spinal cord.
mammalian spinal cord by X-irradiation of the lesion site.
J Neurosci 2002;22(16):7111–7120.
Proc Natl Acad Sci USA 1996;93:11179–11184.
22. Ramon-Cueto A. Olfactory ensheathing glia transplantation 3. Zeman RJ, Feng Y, Peng H, Visintainer PF, Moorthy CR, into the injured spinal cord. Prog Brain Res 2000;128:265– Couldwell WT, Etlinger JD. X-irradiation of the con- tusion site improves locomotor and histological outcomes 23. Popovich PG, Guan Z, McGaughy V, Fisher L, Hickey WF, in spinal cord-injured rats. Exp Neurol 2001;172(1):228– Basso DM. The neuropathological and behavioral conse- quences of intraspinal microglial/macrophage activation.
4. Schwab ME. Myelin-associated inhibitors of neurite growth J Neuropathol Exp Neurol 2002;61(7):623–633.
and regeneration in the CNS. Trends Neurosci 1990;13(11): 24. Fitch MT, Doller C, Combs CK, Landreth GE, Silver J.
Cellular and molecular mechanisms of glial scarring and 5. Schwab ME. Myelin-associated inhibitors of neurite growth.
progressive cavitation: In vivo and in vitro analysis of Exp Neurol 1990;109(1):2–5.
inflammation-induced secondary injury after CNS trauma.
6. Bregman BS, Kunkel-Bagden E, Schnell L, Dai HN, Gao D, J Neurosci 1999;19(19):8182–8198.
Schwab ME. Recovery from spinal cord injury mediated 25. Dusart I, Schwab ME. Secondary cell death and the inflam- by antibodies to neurite growth inhibitors. Nature 1995; matory reaction after dorsal hemisection of the rat spinal cord. Eur J Neurosci 1994;6(5):712–724.
7. Merkler D, Metz GA, Raineteau O, Dietz V, Schwab ME, 26. Rochkind S, Rousso M, Nissan M, Villarreal M, Barr-Nea L, Fouad K. Locomotor recovery in spinal cord-injured rats Rees DG. Systemic effects of low-power laser irradiation treated with an antibody neutralizing the myelin-associated on the peripheral and central nervous system, cutaneous neurite growth inhibitor Nogo-A. J Neurosci 2001;21(10): wounds, and burns. Lasers Surg Med 1989;9(2):174–182.
27. Whelan HT, Smits RL, Jr., Buchman EV, Whelan NT, 8. Zuo J, Neubauer D, Dyess K, Ferguson TA, Muir D.
Turner SG, Margolis DA, Cevenini V, Stinson H, Ignatius R, Degradation of chondroitin sulfate proteoglycan enhances Martin T, Cwiklinski J, Philippi AF, Graf WR, Hodgson B, the neurite-promoting potential of spinal cord tissue. Exp Gould L, Kane M, Chen G, Caviness J. Effect of NASA light- emitting diode irradiation on wound healing. J Clin Laser 9. Lemons ML, Howland DR, Anderson DK. Chondroitin Med Surg 2001;19(6):305–314.
sulfate proteoglycan immunoreactivity increases following 28. Snyder SK, Byrnes KR, Borke RC, Sanchez A, Anders JJ.
spinal cord injury and transplantation. Exp Neurol 1999; Quantitation of calcitonin gene-related peptide mRNA and neuronal cell death in facial motor nuclei following axotomy 10. Houweling DA, Lankhorst AJ, Gispen WH, Bar PR, Joosten and 633 nm low power laser treatment. Lasers Surg Med EA. Collagen containing neurotrophin-3 (NT-3) attracts regrowing injured corticospinal axons in the adult rat spinal 29. Anders JJ, Borke RC, Woolery SK, Van de Merwe WP. Low cord and promotes partial functional recovery. Exp Neurol power laser irradiation alters the rate of regeneration of the rat facial nerve. Lasers Surg Med 1993;13(1):72–82.
11. Liu Y, Himes BT, Murray M, Tessler A, Fischer I. Grafts of 30. Karu T. The science of low power laser therapy. Amsterdam, BDNF-producing fibroblasts rescue axotomized rubrospinal The Netherlands: Gordon Breach Science Publishers; 1998.
neurons and prevent their atrophy. Exp Neurol 2002;178(2): 31. Mochizuki-Oda N, Kataoka Y, Cui Y, Yamada H, Heya M, Awazu K. Effects of near-infra-red laser irradiation on 12. Giehl KM, Schutte A, Mestres P, Yan Q. The survival- adenosine triphosphate and adenosine diphosphate con- promoting effect of glial cell line-derived neurotrophic factor tents of rat brain tissue. Neurosci Lett 2002;323(3):207– on axotomized corticospinal neurons in vivo is mediated by an endogenous brain-derived neurotrophic factor mechan- 32. Castro ESO Jr., Zucoloto S, Marcassa LG, Marcassa J, ism. J Neurosci 1998;18(18):7351–7360.
Kurachi C, Melo CA, Ramalho FS, Ramalho LN, Bagnato 13. Jakeman LB, Wei P, Guan Z, Stokes BT. Brain-derived VS. Spectral response for laser enhancement in hepatic neurotrophic factor stimulates hindlimb stepping and regeneration for hepatectomized rats. Lasers Surg Med sprouting of cholinergic fibers after spinal cord injury. Exp 33. Tuner J, Hode L. Laser therapy: Clinical practice and 14. Houweling DA, van Asseldonk JT, Lankhorst AJ, Hamers scientific background. Tallinn, Estonia: Prima Books AB; FP, Martin D, Bar PR, Joosten EA. Local application of collagen containing brain-derived neurotrophic factor de- 34. Rochkind S, Barr-Nea L, Bartal A, Nissan M, Lubart R, creases the loss of function after spinal cord injury in the Razon N. New methods of treatment of severely injured adult rat. Neurosci Lett 1998;251(3):193–196.
sciatic nerve and spinal cord. An experimental study. Acta 15. David S, Aguayo AJ. Axonal elongation into peripheral Neurochir Suppl 1988;43:91–93.
nervous system bridges after central nervous system injury 35. Rochkind S, Ouaknine GE. New trend in neuroscience: Low- in adult rats. Science 1981;214:913–933.
power laser effect on peripheral and central nervous system 16. Cheng H, Cao Y, Olson L. Spinal cord repair in adult (basic science, preclinical and clinical studies). Neurol Res paraplegic rats: Partial restoration of hind limb function.
36. Rochkind S, Shahar A, Nevo Z. An innovative approach to 17. Li Y, Raisman G. Schwann cells induce sprouting in motor induce regeneration and the repair of spinal cord injury.
and sensory axons in the adult rat spinal cord. J Neurosci Laser Ther 1997;9:151–152.
37. Lagord C, Berry M, Logan A. Expression of TGFbeta2 but 18. McDonald JW, Liu XZ, Qu Y, Liu S, Mickey SK, not TGFbeta1 correlates with the deposition of scar tissue Turetsky D, Gottlieb DI, Choi DW. Transplanted embryo- in the lesioned spinal cord. Mol Cell Neurosci 2002;20(1): nic stem cells survive, differentiate and promote recovery in injured rat spinal cord. Nat Med 1999;5(12):1410– 38. Fitch MT, Silver J. Activated macrophages and the blood– brain barrier: Inflammation after CNS injury leads to in- 19. Diener PS, Bregman BS. Fetal spinal cord transplants creases in putative inhibitory molecules. Exp Neurol 1997; support growth of supraspinal and segmental projections after cervical spinal cord hemisection in the neonatal rat.
39. McKeon RJ, Schreiber RC, Rudge JS, Silver J. Reduction of J Neurosci 1998;18(2):779–793.
neurite outgrowth in a model of glial scarring following CNS BYRNES ET AL.
injury is correlated with the expression of inhibitory molec- 60. Pyner S, Coote JH. Identification of branching paraven- ules on reactive astrocytes. J Neurosci 1991;11:3398–3411.
tricular neurons of the hypothalamus that project to the 40. Isaksson J, Farooque M, Holtz A, Hillered L, Olsson Y.
rostroventrolateral medulla and spinal cord. Neuroscience Expression of ICAM-1 and CD11b after experimental spinal cord injury in rats. J Neurotrauma 1999;16(2):165–173.
61. Metz GA, Merkler D, Dietz V, Schwab ME, Fouad K.
41. Carlson SL, Parrish ME, Springer JE, Doty K, Dossett L.
Efficient testing of motor function in spinal cord injured Acute inflammatory response in spinal cord following impact rats. Brain Res 2000;883(2):165–177.
injury. Exp Neurol 1998;151(1):77–88.
62. Hayashi M, Ueyama T, Nemoto K, Tamaki T, Senba E.
42. Bartholdi D, Schwab ME. Expression of pro-inflammatory Sequential mRNA expression for immediate early genes, cytokine and chemokine mRNA upon experimental spinal cytokines, and neurotrophins in spinal cord injury. J Neuro- cord injury in mouse: An in situ hybridization study. Eur J 63. Ming Y, Bergman E, Edstrom E, Ulfhake B. Reciprocal 43. Perry VH, Gordon S. Modulation of CD4 antigen on changes in the expression of neurotrophin mRNAs in target macrophages and microglia in rat brain. J Exp Med 1987; tissues and peripheral nerves of aged rats. Neurosci Lett 44. Frisen J, Haegerstrand A, Fried K, Piehl F, Cullheim S, 64. Grill R, Murai K, Blesch A, Gage FH, Tuszynski MH.
Risling M. Adhesive/repulsive properties in the injured Cellular delivery of neurotrophin-3 promotes corticospinal spinal cord: Relation to myelin phagocytosis by invading axonal growth and partial functional recovery after spinal macrophages. Exp Neurol 1994;129(2):183–193.
cord injury. J Neurosci 1997;17(14):5560–5572.
45. Dai CF, Kanoh N, Li KY, Wang Z. Study on facial moto- 65. Blits B, Dijkhuizen PA, Boer GJ, Verhaagen J. Intercostal neuronal death after proximal or distal facial nerve transec- nerve implants transduced with an adenoviral vector tion. Am J Otol 2000;21(1):115–118.
encoding neurotrophin-3 promote regrowth of injured rat 46. Popovich PG, Wei P, Stokes BT. Cellular inflammatory res- corticospinal tract fibers and improve hindlimb function.
ponse after spinal cord injury in Sprague–Dawley and Lewis Exp Neurol 2000;164(1):25–37.
rats. J Comp Neurol 1997;377(3):443–464.
66. Schnell L, Schneider R, Kolbeck R, Barde YA, Schwab ME.
47. Benveniste EN. Inflammatory cytokines within the central Neurotrophin-3 enhances sprouting of corticospinal tract nervous system: Sources, function, and mechanism of action.
during development and after adult spinal cord lesion.
Am J Physiol 1992;263(1 Pt 1):C1–C16.
48. Klusman I, Schwab ME. Effects of pro-inflammatory 67. von Meyenburg J, Brosamle C, Metz GA, Schwab ME.
cytokines in experimental spinal cord injury. Brain Res Regeneration and sprouting of chronically injured corticosp- inal tract fibers in adult rats promoted by NT-3 and the mAb 49. Pan JZ, Ni L, Sodhi A, Aguanno A, Young W, Hart RP.
IN-1, which neutralizes myelin-associated neurite growth Cytokine activity contributes to induction of inflamma- inhibitors. Exp Neurol 1998;154(2):583–594.
tory cytokine mRNAs in spinal cord following contusion.
68. Li WW, Yew DT, Chuah MI, Leung PC, Tsang DS.
J Neurosci Res 2002;68(3):315–322.
Axonal sprouting in the hemisected adult rat spinal cord.
50. Popovich PG, Guan Z, Wei P, Huitinga I, van Rooijen N, Stokes BT. Depletion of hematogenous macrophages pro- 69. Tracey DJ. Ascending and descending pathways in the motes partial hindlimb recovery and neuroanatomical repair spinal cord. In: Paxinos G, editor. The rat nervous system, after experimental spinal cord injury. Exp Neurol 1999; 2nd edn. San Diego, CA: Academic Press; 1995. pp 67–80.
70. Brosamle C, Schwab ME. Cells of origin, course, and termi- 51. Hirschberg DL, Yoles E, Belkin M, Schwartz M. Inflamma- nation patterns of the ventral, uncrossed component of the tion after axonal injury has conflicting consequences for mature rat corticospinal tract. J Comp Neurol 1997;386(2): recovery of function: Rescue of spared axons is impaired but regeneration is supported [see comments]. J Neuroimmunol 71. Hicks SP, D'Amato C. Locating corticospinal neurons by retrograde axonal transport of horseradish peroxidase. Exp 52. Chikawa T, Ikata T, Katoh S, Hamada Y, Kogure K, Fukuzawa K. Preventive effects of lecithinized superoxide 72. Usenik EA, Cronkite EP. Effects of barbiturate anesthetics dismutase and methylprednisolone on spinal cord injury in on leukocytes in normal and splenectomized dogs. Anesth rats: Transcriptional regulation of inflammatory and neuro- trophic genes. J Neurotrauma 2001;18(1):93–103.
73. Weiss M, Buhl R, Birkhahn A, Mirow N, Schneider M, 53. Ilev I, Waynant R, Reiter M. Smart optical fiber probes for Wernet P. Do barbiturates and their solutions sup- precise tissue treatment. Proc SPIE 2002;4616:220–228.
press FMLP-induced neutrophil chemiluminescence? Eur J 54. Guest JD, Rao A, Olson L, Bunge MB, Bunge RP. The ability of human Schwann cell grafts to promote regeneration in the 74. Pettigrew DB, Crutcher KA. White matter of the CNS transected nude rat spinal cord. Exp Neurol 1997;148(2): supports or inhibits neurite outgrowth in vitro depending on geometry. J Neurosci 1999;19(19):8358–8366.
55. Plant GW, Christensen CL, Oudega M, Bunge MB. Delayed 75. Huang DW, McKerracher L, Braun PE, David S. A ther- transplantation of olfactory ensheathing glia promotes apeutic vaccine approach to stimulate axon regeneration in sparing/regeneration of supraspinal axons in the contused the adult mammalian spinal cord. Neuron 1999;24(3):639– adult rat spinal cord. J Neurotrauma 2003;20(1):1–16.
56. Bentivoglio M, Kuypers HG, Catsman-Berrevoets CE, 76. Kalderon N, Fuks Z. Severed corticospinal axons recover Loewe H, Dann O. Two new fluorescent retrograde neuronal electrophysiologic control of muscle activity after X-ray tracers which are transported over long distances. Neurosci therapy in lesioned adult spinal cord. Proc Natl Acad Sci 57. Bernstein-Goral H, Bregman BS. Axotomized rubrospinal 77. Bregman BS. Recovery of function after spinal cord injury: neurons rescued by fetal spinal cord transplants maintain Transplantation strategies. In: Dunnett SB, Bjo¨rklund A, axon collaterals to rostral CNS targets. Exp Neurol 1997; editors. Functional neural transplantation. New York: Raven Press; 1994. pp 489–529.
58. Asada Y, Kawaguchi S, Hayashi H, Nakamura T. Neural 78. Kunkel-Bagden E, Dai HN, Bregman BS. Methods to assess repair of the injured spinal cord by grafting: Comparison the development and recovery of locomotor function after between peripheral nerve segments and embryonic homo- spinal cord injury in rats. Exp Neurol 1993;119(2):153–164.
logous structures as a conduit of CNS axons. Neurosci Res 79. Metz GA, Whishaw IQ. Cortical and subcortical lesions impair skilled walking in the ladder rung walking test: A 59. Systems Planning and Analysis I. The stereology hand- new task to evaluate fore- and hindlimb stepping, placing, book. Alexandria, VA: Systems Planning and Analysis, Inc.; and co-ordination. J Neurosci Methods 2002;115(2):169– LIGHT PROMOTES REGENERATION AND FUNCTIONAL RECOVERY 80. Garcia-Alias G, Lopez-Vales R, Fores J, Navarro X, Verdu E.
93. Ma M, Wei T, Boring L, Charo IF, Ransohoff RM, Acute transplantation of olfactory ensheathing cells or Jakeman LB. Monocyte recruitment and myelin removal Schwann cells promotes recovery after spinal cord injury are delayed following spinal cord injury in mice with CCR2 in the rat. J Neurosci Res 2004;75(5):632–641.
chemokine receptor deletion. J Neurosci Res 2002;68(6): 81. Teng Q, Tanase DK, Liu JK, Garrity-Moses ME, Baker KB, Boulis NM. Adenoviral clostridial light chain gene-based 94. Bao F, Liu D. Peroxynitrite generated in the rat spinal cord synaptic inhibition through neuronal synaptobrevin elim- induces neuron death and neurological deficits. Neuro- ination. Gene Ther 2005;12(2):108–119.
82. Delves PJ, Roitt IM. The immune system. First of two parts.
95. Karu TI, Pyatibrat LV, Ryabykh TP. Nonmonotonic beha- N Engl J Med 2000;343(1):37–49.
vior of the dose dependence of the radiation effect on cells 83. Koshinaga M, Whittemore SR. The temporal and spatial in vitro exposed to pulsed laser radiation at lambda ¼ activation of microglia in fiber tracts undergoing antero- 820 nm. Lasers Surg Med 1997;21(5):485–492.
grade and retrograde degeneration following spinal cord 96. Karu T, Tiphlova O, Esenaliev R, Letokhov V. Two different lesion. J Neurotrauma 1995;12(2):209–222.
mechanisms of low-intensity laser photobiological effects 84. Mabon PJ, Weaver LC, Dekaban GA. Inhibition of monocyte/ on Escherichia coli. J Photochem Photobiol B 1994;24(3): macrophage migration to a spinal cord injury site by an antibody to the integrin alphaD: A potential new anti-in- 97. Passarella S, Casamassima E, Molinari S, Pastore D, flammatory treatment. Exp Neurol 2000;166(1):52–64.
Quagliariello E, Catalano IM, Cingolani A. Increase of 85. Taoka Y, Okajima K. Spinal cord injury in the rat. Prog proton electrochemical potential and ATP synthesis in rat liver mitochondria irradiated in vitro by helium–neon laser.
86. Xu J, Fan G, Chen S, Wu Y, Xu XM, Hsu CY. Methylpredni- FEBS Lett 1984;175(1):95–99.
solone inhibition of TNF-alpha expression and NF-kB acti- 98. Enwemeka CS. Laser biostimulation of healing wounds: vation after spinal cord injury in rats. Brain Res Mol Brain Specific effects and mechanisms of action. J Orthop Sports Phys Ther 1988;9:333–338.
87. Streit WJ, Semple-Rowland SL, Hurley SD, Miller RC, 99. Yu W, Naim JO, McGowan M, Ippolito K, Lanzafame RJ.
Popovich PG, Stokes BT. Cytokine mRNA profiles in Photomodulation of oxidative metabolism and electron chain contused spinal cord and axotomized facial nucleus suggest enzymes in rat liver mitochondria. Photochem Photobiol a beneficial role for inflammation and gliosis. Exp Neurol 100. Karu T. Primary and secondary mechanisms of action of 88. McTigue DM, Tani M, Krivacic K, Chernosky A, Kelner GS, visible to near-IR radiation on cells. J Photochem Photobiol Maciejewski D, Maki R, Ransohoff RM, Stokes BT. Selec- tive chemokine mRNA accumulation in the rat spinal cord 101. Beauvoit B, Kitai T, Chance B. Contribution of the after contusion injury. J Neurosci Res 1998;53(3): 368–376.
mitochondrial compartment to the optical properties of the 89. Satake K, Matsuyama Y, Kamiya M, Kawakami H, Iwata H, rat liver: A theoretical and practical approach. Biophys J Adachi K, Kiuchi K. Nitric oxide via macrophage iNOS induces apoptosis following traumatic spinal cord injury.
102. Wong-Riley MT, Liang HL, Eells JT, Chance B, Henry Brain Res Mol Brain Res 2000;85(1-2):114–122.
MM, Buchmann E, Kane M, Whelan HT. Photobiomodula- 90. Eng LF, Lee YL. Response of chemokine antagonists to tion directly benefits primary neurons functionally inacti- inflammation in injured spinal cord. Neurochem Res 2003; vated by toxins: Role of cytochrome c oxidase. J Biol Chem 2005; (in press).
91. Ghirnikar RS, Lee YL, Eng LF. Chemokine antagonist 103. Lubart R, Friedmann H, Levinshal T, Lavie R, Breitbart H.
infusion attenuates cellular infiltration following spinal cord Effect of light on calcium transport in bull sperm cells.
contusion injury in rat. J Neurosci Res 2000;59(1):63–73.
J Photochem Photobiol B 1992;15(4):337–341.
92. Ghirnikar RS, Lee YL, Eng LF. Chemokine antagonist 104. Lubart R, Breitbart H. Biostimulative effects of low energy infusion promotes axonal sparing after spinal cord contusion lasers and their implications for medicine. Drug Develop- injury in rat. J Neurosci Res 2001;64(6):582–589.
ment Res 2000;50:471–475.

Source: http://www.nupen.com.br/port/odontologia/od_bibli/junho_2007/Byrnes_regeneration_2005.pdf

15-daagse rondreis israël

15-tägige Rundreise nach Jordanien 19. Mai - 2. Juni 2014 3 Meere – 3 Wüsten – 3 Städte. Höhepunkte: 7 Offenbarungsberge Gottes – Tiefstpunkt der Erde: Das Tote Meer Israel, das Land in dem Gott Geschichte gemacht hat. Wir besuchen berühmte Städte wie Tel

myrcc.sunyrockland.edu

145 College Road, Suffern, NY 10901 Rockland Community College Number PUBLIC SAFETY .574-4211 / 4217 / 4238 Security Escort .574-4217 Emergency/Medical .574-4211 / 4217 SNOW EMERGENCY INFORMATION .574-4034 ROCKLAND COMMUNITY COLLEGE Main Campus 574-4000 145 College Road, Suffern, NY 10901