Marys Medicine

Nuweb9.neu.edu

Replication fork stalling and Y-family polymerases tion is arrested through substrate starvation (Sneeden and been deleted is as sensitive to killing by HU as its umuD þ C þ Loeb, 2004).
parent. Intriguingly, a strain carrying a precise DumuC dele- We report that the E. coli Y-family polymerases Pol IV tion that leaves the umuD þ gene intact displays a modest and Pol V play a role upon DNA damage-independent replica- level of resistance to killing (Figure 1A). Perhaps, either or tion stalling. Strains bearing novel umuC alleles are unex- both of the umuD þ gene products might contribute to HUR in pectedly HUR, challenging the notion that replication the absence of UmuC (see below).
inhibition by HU arises solely from dNTP starvation.
We also tested umuC122HTn5 (umuC122), which is Genetic analyses demonstrate that the dinB and umuD gene known to behave as a umuC null allele with respect to products also participate in the DNA damage-independent induced mutagenesis caused by UV radiation and many response to inhibition of replication fork progression.
chemicals (Elledge and Walker, 1983; Sargentini and Smith, Together, these data suggest combined action of the UmuC 1984; Christensen et al, 1988; Bates et al, 1991). We found derivatives together with the dinB and umuD gene products that strains carrying umuC122 are at least 100-fold more at these stalled replication forks. Moreover, we also find that resistant to killing by HU than their umuC þ parents and the lethality of such replication fork arrest in wild-type can in fact multiply during HU treatment (Figure 1A). We derivatives is alleviated independently by mutation of observed this HUR phenotype in all strain backgrounds the mazEF and relBE toxin/antitoxin pairs, suggesting that tested, including AB1157 (Figure 1B; Bachmann, 1987).
the action of these Y-family polymerases may prevent mazEF- These observations indicate that umuC122 is a gain-of-func- or relBE-mediated lethality under conditions of nucleotide tion umuC allele with regard to cell survival after HU treat- ment. This is plausible as the Tn5 insertion results in amissense mutation followed immediately by a terminationcodon giving rise to a predicted 32 kDa UmuC protein lacking its last 102 residues (Koch et al, 1992). The truncation occurs E. coli carrying the umuC122HTn5 allele are
downstream of the conserved polymerase domain common unexpectedly resistant to HU
to Y-family DNA polymerases (Boudsocq et al, 2002).
We were interested in whether the umuC þ gene product Immunoblotting confirmed that the umuC122 allele indeed might be part of the cellular response when replication fork encodes a UmuC derivative of this molecular weight progression is inhibited in a DNA damage-independent man- (Figure 1C). We observed that the truncated UmuC122 pro- ner by dNTP depletion. We therefore examined a set of strains tein appears to be expressed at higher levels than wild-type carrying null alleles of umuC for their sensitivity to killing by UmuC (data not shown), although this may be because one of HU (Figure 1A). A strain in which the umuDC operon has the synthetic peptides used to raise antibodies against UmuC Figure 1 Bacterial cells bearing the umuC122 allele are HUR. (A) Survival time course in hydroxyurea reveals HUR of a strain bearing theumuC122 allele (open circles). In comparison, a strain bearing a DumuC allele (closed triangles) is slightly HUR, whereas both parental (closedcircles) and DumuDC strains (open triangles) are sensitive to the reagent. CFUs were determined by serial dilution. Error bars represent thestandard deviation determined from at least five samples. (B) Comparison of survival in HU of both AB1157 and P90C backgrounds. Error barsrepresent the standard deviation determined from at least five samples. (C) The truncated UmuC122 protein is expressed in vivo as determinedby immunoblotting. Lane 1 shows a cell-free extract from a DumuDC strain with vector only (pGB2), lane 2 shows the same strain but insteadbearing the plasmid pDC, and lanes 3 and 4 show two independent isolates of the same strain bearing pDC122. Plasmid-borne copies were usedto facilitate detection of UmuC in the absence of SOS induction.
& 2006 European Molecular Biology Organization VOL 25 NO 4 2006 869

Replication fork stalling and Y-family polymerasesVG Godoy et al lies immediately at the C-terminus of the UmuC122 protein, Resistance to HU requires the catalytic activity of the
perhaps resulting in a more accessible epitope relative to full- truncated UmuC122 protein
length UmuC. The UmuC122 protein may also lack one or To facilitate further analysis of the genetic requirements for more C-terminal motifs that would normally target the pro- umuC122-mediated HUR, we tested whether a plasmid-borne tein for Lon-mediated proteolytic degradation (Frank et al, umuDumuC122 (pDC122), expressed in a DumuDC deriva- 1996). Overexpression of UmuC did not confer statistically tive, conferred HUR. This was indeed the case (Figure 3A). To significant HUR (data not shown).
determine whether this HUR requires the catalytic activity ofUmuC122, we used the umuC104 allele (D101N) (Figure 3D)(Koch et al, 1992), which alters a conserved catalytic residue The umuC122 allele alleviates the lethal effects of class I
common to all Y-family polymerases (Boudsocq et al, 2002).
RNR inhibition by HU
The addition of pDC104 had little effect on resistance to The observation of an HUR phenotype as a consequence of a killing by HU (Figure 3A). However, introduction of the umuC mutation was unanticipated as most previously repor- D101N mutation into pDC122 eliminated HUR (Figure 3A), ted HUR mutants affect RNR (Sneeden and Loeb, 2004). By indicating that the UmuC122 protein must be catalytically immunoblotting, we showed that the levels of the small and active to observe this phenotype.
large subunits of RNR are not affected during HU treatment instrains bearing the umuC122 allele (Figure 2A). Also, we foundthat the protective effect of umuC122 is observed with other A unique umuC missense allele also confers resistance
RNR inhibitors such as guanazole (Figure 2B). We sought evidence that the umuC122 mutation helps cells recover from We also tested the response to HU of umuC125, a umuC allele the lethal consequences of HU-mediated RNR inhibition in- bearing an A39V mutation, which does not affect the ability stead of acting by some other mechanism. Therefore, we took of UmuC to function in UV mutagenesis, but eliminates the advantage of the fact that anaerobically grown E. coli utilize an cold sensitivity observed when it is overexpressed together HU-insensitive class III RNR rather than the HU-sensitive class with UmuD (Marsh et al, 1991; Sutton and Walker, 2001b).
I RNR used during aerobic growth (Fontecave et al, 1989). As We found that DumuDC cells containing pDC125, the plas- shown in Figure 2C, we found that the anaerobically grown mid-borne version of umuC125, are also resistant to HU, HU-treated umuC þ and umuC122 strains were both insensi- although not to as high a level as observed with pDC122 tive to HU. These observations indicate that the umuC122 (Figure 3A). This observation indicates that HUR is not a mutation alleviates the lethality caused by HU inhibition of the unique property of the umuC122 allele, but can be mimicked, class I RNR in E. coli through a mechanism that does not at least in part, by a simple missense mutation affecting the involve alteration of RNR protein levels.
N-terminus of UmuC.
Figure 2 HUR proceeds through RNR inhibition. (A) Immunoblot of large and small subunits of RNR shows no difference in levels betweenwild-type (lanes 1 and 2) and umuC122 (lanes 3 and 4) strains during HU treatment. Lanes 1 and 3 contain twice as much total protein as lanes2 and 4 (3.25 mg of total protein). (B) umuC122 also alleviates cell death during challenge with other RNR inhibitors. The left panel showsresults of treatment with 100 mM guanazole, whereas untreated results are shown on the right. Lane 1 shows the parental P90C strain, lane 2shows the DumuDC strain, lane 3 shows umuC122 and lane 4 shows the DumuC strain. (C) Class I RNR is sensitive to HU, whereas class IIIRNR, used exclusively in anaerobic growth, is indifferent to the reagent. The parental (P90C) and umuC122 strains were treated with HU for 6 hwith ( þ O2) and without (O2) oxygen. CFUs reported are the average of four samples and error bars represent the standard deviation asdetermined from these samples.
870 The EMBO Journal VOL 25 NO 4 2006
& 2006 European Molecular Biology Organization

Replication fork stalling and Y-family polymerases Figure 3 umuC requirements for observation of HUR. (A) In a DumuDC strain, addition of the plasmid-borne umuC alleles pDC122 andpDC125 confer HUR. pDC122 carries the umuD þ gene, but umuC has a stop codon at residue 322, thus reconstructing the truncated allelepresent on the chromosome by virtue of the Tn5 insertion. pDC104 encodes UmuC(D101N), rendering UmuC catalytically inactive, whereaspDC122C104 encodes UmuC122(D101N). pDC125 encodes UmuC(A39V), an allele that separates the UV-induced mutagenesis and cold-sensitivity phenotypes of umuC. CFUs were determined by serial dilution, and treatment was carried out with Sp (for plasmid maintenance)and 50 mM HU. Values reported are the average of three experiments and error bars represent the standard deviation obtained from thosevalues. (B) The umuD gene products are also required for HUR. The resistance conferred by a plasmid-borne umuC122 allele depends upon theumuD gene products. pD(S60A)C122 is as pDC122 but encodes a UmuD protein with a mutation (S60A) rendering the protein unable toundergo autoproteolysis to become UmuD0. The plasmid pD0C122 is as pDC122 but encodes only UmuD0 instead of the full-length protein.
Reported values are the average of three experiments and error bars represent the standard deviation as determined from those experiments.
(C) The umuD gene products are also required for the HUR conferred by umuC125. Plasmids and data analysis are as in (B). (D) A structuralrepresentation of the UmuC active site reveals the proximity of A39 to residues essential for catalysis (D6, D101). The template is shown in red,and the primer in green. Model is courtesy of Dr D Barksy (LLNL, Livermore, CA).
The umuD þ gene is required for HU resistance
UmuC. Furthermore, the umuD þ gene products influence the The data presented in Figure 1A suggest that the umuD þ biological function of UmuC (Nohmi et al, 1988; Woodgate gene product(s) might contribute to HUR in the absence of et al, 1989). We therefore assessed whether either form of the & 2006 European Molecular Biology Organization VOL 25 NO 4 2006 871

Replication fork stalling and Y-family polymerasesVG Godoy et al umuD þ gene product is required for the high level of HUR pDC125, whereas the strain bearing pD0C125 showed sub- we observed in umuC122 bearing strains. The umuD(S60A) stantially less HUR. These data, combined with the fact that mutation (Koch et al, 1992; McLenigan et al, 1998) eliminates the level of HUR of a umuC125 strain is less than that of a the serine that serves as the nucleophile in RecA-mediated umuC122 strain (Figure 3A), suggest that the UmuC125 UmuD autocleavage, so that only full-length UmuD is pro- protein is less proficient at the UmuD0-dependent component duced [pD(S60A)C]. Alternatively, the DNA encoding the first of HUR than the UmuC122 protein.
24 amino acids in the N-terminus of UmuD can be deletedso that UmuD0 is synthesized directly (pD0C) (Nohmi et al, The dinB þ gene is required for HUR
The results presented to this point indicate that the high-level As shown in Figure 3B, DumuDC cells with a plasmid resistance of certain umuC mutants to killing by HU also carrying umuD(S60A)umuC122 [pD(S60A)C122] exhibited a requires certain forms of the UmuD protein. Involvement lower level of HUR than the corresponding cells bearing the of DinB in HUR would be consistent with reports that umuC122 plasmid (pDC122), but nevertheless were substan- DinB cooperates with UmuC in TLS past certain lesions tially HUR. Similarly, DumuDC cells bearing pD0C122 exhi- (Napolitano et al, 2000; Sommer et al, 2003). Furthermore, bited a lower level of HUR than the corresponding pDC122 under both induced and uninduced conditions, the intracel- bearing strain, but were still HUR. These results suggest that lular levels of the umuD gene products are much higher than the full degree of HUR displayed by a umuD þ umuC122 strain the estimated intracellular concentrations of UmuC, but are requires both forms of the umuD þ gene product. The two approximately equal to those of DinB (Woodgate and Ennis, forms might act sequentially, first the UmuD2 homodimer and 1991; Kim et al, 2001). Therefore, we constructed a strain 2 homodimer. If so, it would appear that the with a precise deletion of the dinB þ gene in umuC þ and component of HUR requiring UmuD2 is more substantial than umuC122 backgrounds. In a umuC þ strain, loss of dinB þ the component requiring UmuD 0 2 . Another possibility is that results in a slight sensitivity to HU (Figure 4A). However, a component of the HUR requires the action of the introduction of the DdinB mutation into the strain carrying UmuD . UmuD0 heterodimer, which is known to be the most the umuC122 allele eliminates the high level of HUR observed stable form in vitro (Battista et al, 1990).
in this strain (Figure 4A). Thus, the dinB þ gene product is We performed similar experiments with the umuC125 essential for the HUR exhibited in umuC122 strains.
plasmid-borne allele (Figure 3C, note y-axis scale) in which we examined HUR when umuD(S60A) and umuD0 were umuC122DdinB mutant by introducing plasmids carrying combined with umuC125. Interestingly, in contrast to the the dinB þ gene. We were unable to complement HUR situation with umuC122, the strain bearing pD(S60A)C125 in trans with low- or high-copy number plasmids bearing displayed comparable HUR relative to the strain bearing dinB þ . However, by transducing the wild-type copy of the Figure 4 The dinB gene and its catalytic activity are necessary to avert HU lethality. (A) The HUR of a umuC122 dinB þ strain (open circles) iseliminated by deletion of the dinB gene (closed triangles). In contrast, deletion of the dinB gene has only a mild effect on the parental strain(open triangles and closed circles). (B) Reconstruction of the dinB þ locus on the chromosome restores HUR to the umuC122 DdinB strain.
However, transduction of the dinB003 allele, which encodes a catalytically inactive DinB(D103N), does not restore HUR, indicating that thecatalytic activity of DinB is required. Treatment was for 6 h with 100 mM HU in rich medium. umuC122 dinB þ refers to the reconstructed wild-type gene with a linked cat gene upstream the dinB promoter. Reported values are the average of three experiments and error bars represent onestandard deviation.
872 The EMBO Journal VOL 25 NO 4 2006
& 2006 European Molecular Biology Organization Replication fork stalling and Y-family polymerases Figure 5 DNA synthesis is slowed in both wild-type and umuC122 strains. Thymidine-requiring derivatives of both strains were used for theexperiments shown. 3H-Thy was added at 1 mCi/ml for 10 min at each time point shown, after which cells were immediately precipitated with10% TCA. For both the wild-type shown in (A) (circles) and umuC122 shown in (B) (squares) strains, bulk DNA replication is slowed duringhydroxyurea treatment. The straight line represents the background c.p.m. Error bars represent the standard deviation of three samples.
dinB þ gene into the umuC122DdinB mutant, the HUR pheno- competence to develop colonies, between the HU-treated type was restored (Figure 4B). The possibility that the wild-type and umuC122 strains. This remarkable and un- restoration is due to a closely linked locus rather than to expected result led us to examine the cells microscopically dinB þ is inconsistent with the data presented in the follow- during HU treatment (see below).
ing section. These observations suggest that the level of DinBexpression or a cis-regulatory element is critical for the ability A strain bearing a mazEF or relBE mutation is also
of dinB þ to contribute to the HUR of a umuC122 strain.
resistant to HU
Perhaps, DinB cannot contribute to HUR if its levels do not Although wild-type and umuC122 strains display comparable correlate with those of the products of the umuD þ gene.
levels of bulk DNA synthesis during HU treatment, only inthe umuC122 mutant is this activity beneficial for survival. It The catalytic activity of DinB is required for HU
seemed possible that the wild-type strain loses viability not directly due to stalled replication forks that arise during HU To test whether DinB must be catalytically active to contri- treatment, but instead due to events that occur downstream bute to HUR, we introduced the dinB003 mutation into the of such stalled forks. Examination by microscopy of an HU- chromosome of a umuC122 strain. This mutation (D103N) treated parental culture revealed drastically fewer cells alters a conserved aspartic acid residue required for phos- (490% reduction at 5 h) than in the umuC122 strain, most phodiester bond formation (Wagner and Nohmi, 2000). The likely due to cell lysis. Hence, we considered the phenomen- large loss of HUR we observed (Figure 4B) suggests that DinB on of thymineless death, which is also thought to be the is indeed acting as a DNA polymerase as it contributes to product of stalled replication forks formed by substrate HUR. Thus, it appears that HUR results from the combined starvation (Ahmad et al, 1998). In E. coli strain MC4100, action of two DNA polymerases, DinB and a mutant form of thymineless death is mediated at least in part by the mazEF UmuC, acting together with UmuD and UmuD0.
genes (Sat et al, 2003), which encode a toxin–antitoxin pair.
We speculated that HUR and thymineless death may proceed DNA synthesis is slowed in both parental and umuC122
through similar mechanisms.
strains during HU challenge
Therefore, we examined the sensitivity to HU of an To explain the observation that both Y-family polymerases MC4100 derivative harboring a deletion of the mazEF genes are required for HUR, we asked whether HUR was simply due (Aizenman et al, 1996). Not only does deletion of these genes to an extensive alteration in the rate of DNA replication. We protect cells from the lethal consequences of HU challenge measured DNA synthesis by examining the ability of thymi- (Figure 6A), but the mechanism of HUR is also likely to be dilate synthase-negative (thyA) derivatives of wild-type and related to that of the umuC122 strain. Microscopical exam- umuC122 strains to incorporate thymidine (3H-Thy) in 10 min ination during HU treatment indicates that umuC122 and pulses during HU treatment. We found that the amount of mazEF strains appear quite similar at the single-cell level DNA synthesis is reduced during HU treatment in both wild- (Figure 6B). No morphological difference is visible among the type and umuC122 strains compared to untreated controls strains 1 h into HU treatment (panels A–D), but each HUS (Figures 5A and B). Any minor changes that we observe in parental strain had to be concentrated an additional five-fold the ability to incorporate 3H-Thy into the DNA do not appear to analyze comparable numbers of cells relative to its HUR to account for the striking difference in viability, that is, derivative. Finally, at 5 h (panels E–H), we observed similar & 2006 European Molecular Biology Organization VOL 25 NO 4 2006 873

Replication fork stalling and Y-family polymerasesVG Godoy et al Figure 6 Survival phenotypes under dNTP starvation. (A) Survival time course in 100 mM HU of the parental MC4100 derivative (closedcircles) and the mazEF mutant strain (open circles) in LB. Error bars shown represent the standard deviation of two samples. (B) Strainsbearing the indicated alleles and wild-type control backgrounds were treated with 100 mM HU to determine cell morphology under HUtreatment. Micrographs are presented for treated cells only because untreated samples of each strain showed indistinguishable morphologiesover 5 h without HU. Panels A–D show representative images of cells after 1 h of HU treatment. (A, B) P90C wild-type and umuC122 controlDIC image, (C, D) MC4100 wild-type and mazEF control DIC image. Images labeled 1 show DAPI staining, images labeled 2 show DEADstaining and images labeled 3 show LIVE staining. Panels E–H are corresponding representative images of cells following treatment with HU for5 h. Images were colorized using OpenLab software (Improvision) and were sized in Canvas (Deneba Systems). The white bar in (A) represents2 mm. Exposure times for the images were as follows: DIC, 0.03 s; DAPI, 0.13 s; LIVE, 0.01 s; and DEAD, 0.13 s. The LIVE/DEAD stain was usedaccording to the manufacturer's recommendations (Molecular Probes). (C) Mutation in the relBE gene products protects (denotes relB in thisfigure) cells from thymine starvation. Error bars represent the standard deviation of three samples. (D) Deletion of the relBE genes alsopromotes HUR. Treatment with Tp in HM21 (4 mg/ml) and P90C (7 mg/ml) strains was performed in appropriately supplemented M9 minimalmedium. CFUs were determined after 16 h incubation. HU challenge (100 mM) was carried out in LB appropriately supplemented medium.
Error bars shown represent the standard deviation of three samples.
responses in both HUS parental strains (concentrated E. coli strain HM21, the donor of the mazEF and relBE deletion 15-fold relative to their HUR derivatives). In comparison, the alleles. We tested the mazEF and relBE strains in both back- umuC122 and mazEF strains show extreme elongation and no grounds for HUR and response to thymine starvation using dead cells, suggesting that HUR may arise through a similar trimethoprim (Tp) to inhibit thyA. We found that the relBE mechanism in both strains. Therefore, it is plausible that the deletion protects cells from inhibition of fork progression HUR phenotype of the umuC122 mutant may be due to a upon thymine starvation similarly to mazEF (Figure 6C), and failure to transduce a signal in a mazEF-dependent pathway that both strains showed comparable responses upon HU leading to cell death and lysis (Aizenman et al, 1996).
challenge (Figure 6D). Moreover, we found the umuC122 We then tested whether a different TA pair may protect allele confers resistance to both Tp (Figure 6C) and HU cells from the lethality caused by thymine starvation or HU (Figure 6D) in the HM21 strain background, although this challenge. Thus, we constructed P90C derivatives that har- HUR is of a lower magnitude than that observed in the P90C bored deletions of either the mazEF or relBE genes (Gerdes strain. In contrast, the umuC122 allele does not confer et al, 2005). We also transduced the umuC122 allele into the resistance to Tp in the P90C background. This results suggest 874 The EMBO Journal VOL 25 NO 4 2006
& 2006 European Molecular Biology Organization Replication fork stalling and Y-family polymerases that there may be communication between pathways that Analysis of HU-treated cultures by microscopy (Figure 6B) couple HU- and Tp-induced stalled replication forks to cell revealed not only that the HU-treated wild-type cells die, death, and that a factor(s) involved in such communication but that many also disappear over the course of treatment, is/are absent in the P90C strain, which bears a B105 kb presumably through cell lysis. These data challenged our deletion on its chromosome. Moreover, both pathways expectation that stalled replication forks would simply arrest appear to utilize the relBE and mazEF TA pairs as their cell division and prevent colony formation. We had not anticipated that they would bring about cell lysis in and ofthemselves.
We have shown that cells treated with HU are affected in a HU-treated strains bearing the truncated UmuC protein
process downstream of RNR inhibition (Figures 2B and C).
have a high mutation frequency
The current model for replication stalling elicited by Our findings raise the possibility that the four proteins we dNTP depletion is that substrate starvation brings about have identified as being critical for HUR—DinB, a UmuC fork arrest and concomitant cell death (Roy et al, 2004).
derivative, UmuD, and UmuD0—enhance cell survival under However, HU-treated Saccharomyces cerevisiae cells have conditions of low dNTP concentrations. They may even take been shown to exhibit both normal replication forks that over much of DNA replication, thereby helping cells to can still sustain very slow DNA synthesis, as well as stalled replicate even in the presence of HU (Figure 1A). If DNA replication forks (Sogo et al, 2002; Lopes et al, 2003).
replication upon HU challenge is DinB- and UmuC depen- Moreover, HU-treated S. cerevisiae show a reduction in levels, dent, one would expect such DNA synthesis on undamaged but not an absence, of dNTPs (Koc et al, 2004). Hence, the DNA to be less accurate than that carried out by the DNA Pol dNTP starvation model may be too simplistic to account for III holoenzyme. Therefore, we tested whether the mutation all these observations.
frequency to rifampicin resistance is changed before or after Therefore, we considered whether the HUR mediated by HU treatment in a umuC122 strain. We determined that these gain-of-function alleles of umuC is due to an abrogation untreated strains encoding UmuC122 protein have a sponta- in a pathway that would normally lead to cell death under neous mutation frequency of 472 107, identical to the conditions of dNTP starvation. We found that E. coli strains mutation frequency of the untreated umuC þ parental strain bearing a deletion of such a function (mazEFHKan) (473 107). However, after HU treatment, the mutation (Aizenman et al, 1996) are also HUR (Figures 6A and B).
frequency of the umuC122 strain increases ca. 100-fold to We also found that deletion of relBE protects cells from both 773 105, whereas the mutation frequency of the umuC þ thymine starvation and HU challenge (Figures 6C and D). It is parental strain remains at ca. 107. These data suggest that it likely that the function of the mazEF and relBE gene products may be possible to explain the HUR phenotype of strains is to slow metabolism, thereby enabling stasis and resump- bearing the umuC122 allele by a model in which one or both tion of balanced growth (Pedersen et al, 2002; Gerdes et al, of the Y-family polymerases are responsible for a significantly 2005). However, when challenged with dNTP starvation, cells greater proportion of DNA replication during HU treatment are unable to recover from this stasis and eventually perish.
than under normal conditions.
Based on these data, HU-induced death of E. coli may bebrought about not by stalled replication forks directly, butrather through a series of downstream processes involving the TA pairs mazEF and relBE. The UmuC variants, acting We examined the effect of inhibiting replication fork progres- in combination with the dinB and umuD gene products, may sion in a DNA damage-independent manner with HU in mitigate such mazEF- or relBE-induced death, either directly strains bearing different alleles of the umuC gene and found or indirectly. Further studies will be needed to establish that cells bearing a carboxy-terminal truncation allele whether and to what extent replication fork collapse is umuC122HTn5 (Elledge and Walker, 1983) are strikingly required to signal such lethal pathways, as well as other resistant to HU treatment (Figure 1A). Moreover, an unusual factors that might be involved. It will be interesting to look point mutation in UmuC (umuC125 allele, A39V) (Marsh for a function that would bestow TpR in the P90C umuC122 et al, 1991) displays a similar phenotype (Figures 3A and derivative (Figure 6D). This strain harbors a large deletion D). We have shown that umuC122 is a gain-of-function allele (D(lac-pro), ca. 105 kb) compared to the HM21 background, that mediates HUR and encodes a gene product that could, in where the umuC122 derivative is TpR (Figure 6C).
principle, perform DNA polymerization as its polymerase In E. coli, intracellular dNTP pools are at least 10-fold domain is intact (Boudsocq et al, 2002). DNA polymerase lower (10 mM) in the presence of HU than in untreated cells activity in such a mutant protein is not unprecedented (100 mM) (Sinha and Snustad, 1972; Mathews and Sinha, as truncations of the carboxy-terminal domain of human Y- 1982). One explanation for HU-induced stalled replication family polymerase Z are TLS proficient in vitro (Broughton forks is that the replicative DNA polymerase cannot catalyze et al, 2002). XP-V patients (Masutani et al, 1999) bearing efficient DNA synthesis as its Km for dNTPs (3–40 mM for these C-terminal truncations tend to have more tumors than DNA Pol III) (Kornberg and Baker, 1991) is higher than the those carrying other Pol Z alleles (Broughton et al, 2002).
concentrations of dNTPs present in the HU-treated cells. In Indeed, we show that cells expressing a catalytically inactive comparison, the Km for dNTPs of Pol IV (0.12 mM for His- UmuC122 protein are sensitive to HU (Figure 3A). We have DinB with the b processivity clamp) and Pol V (0.08 mM with also shown that the DinB protein (Figure 4A), and its catalytic RecA versus 1200 mM without) are much lower (Tang et al, activity (Figure 4B), is needed to observe the phenotype. In 2000; Wagner et al, 2000). Therefore, it appears the E. coli addition, we have learned that certain umuD gene products Y-family DNA polymerases have the potential to operate are required for the HUR phenotype (Figures 3B and C).
efficiently at low dNTP concentrations, conditions at which & 2006 European Molecular Biology Organization VOL 25 NO 4 2006 875
Replication fork stalling and Y-family polymerasesVG Godoy et al DNA Pol III would operate poorly. Furthermore, such cap- cells. However, phenomena tested using umuC122 should abilities seem to be dramatically regulated through protein– be reevaluated. In comparison, the A39V mutation in the UmuC125 protein is in close proximity to the active site All these data are consistent with the notion that DinB, ˚ ; Figure 3D). The phenotype conferred by the UmuC, and the umuD gene products are recruited to stalled umuC125 allele may be due to either disruption of regulatory replication forks upon HU treatment. We propose that the protein–protein interactions with similar consequences to the UmuC derivatives alter the highly dynamic process of poly- umuC122 mutation or to alteration of the biochemical proper- merase switching, so that Y-family polymerases are defective ties of the protein, such as a reduction in koff for the primer/ in the switch back to the replicative polymerase. Ordinarily, template, Km for dNTP substrates, or both. In either case, the UmuC, UmuD, and DinB would be part of a transient com- consequence is prolonged access to the replication fork under plex relieving arrested replication forks, regardless of how conditions of nucleotide starvation, resulting in survival they arise. Both Y-family polymerases would work together to during HU challenge.
enhance cell survival, perhaps with DinB extending primers If these polymerases replicate DNA in the presence of HU, that are misaligned on their templates (Wagner et al, 1999) mutability should be markedly higher in the mutant strains and UmuC continuing replication before hand off of the relative to the wild type. Indeed, the umuC122 bearing strain primer terminus to the replicative DNA polymerase. Such displays a 100-fold higher mutation frequency upon HU polymerase switching is regulated by numerous factors in treatment than its untreated counterpart or the wild-type E. coli including the umuD gene products (Sutton and Walker, strain. Intriguingly, before the discovery of Y-family poly- 2001a). In contrast, the UmuC variants would be recruited to merases, it has been reported that imbalances in dNTP pools HU-induced stalled forks and would be proficient to catalyze increase mutagenesis, perhaps by decreasing the fidelity of DNA synthesis, but would be unable to sense the signal to DNA synthesis (Sargent and Mathews, 1987; Ji and Mathews, hand off the primer terminus to the replicative DNA poly- 1991; Mun and Mathews, 1991; Zhang et al, 1996). This merase. Hence, these UmuC derivatives would retain access reduction in fidelity could perhaps now be attributed to the to the replication fork unlike the wild-type protein. The recruitment of such Y-family polymerases to the replication unexpected finding (Figure 5A) that wild-type cells still forks under conditions of nucleotide imbalance.
carry out DNA replication upon HU challenge may be ex-plained by a futile cycling of Y-family polymerase recruitment Materials and methods
and subsequent handoff to the replicative DNA polymerasewhich cannot function effectively at the low dNTP levels Strains and plasmids
of the cell. Furthermore, although umuC122 is nonmutable We used different E. coli K12 strains and their isogenic derivatives in vivo with respect to UV, its gene product may be able to (Table I): P90C (Cairns and Foster, 1991), AB1157 (Bachmann,1987), and HM21 (Moyed and Bertrand, 1983). A precise deletion of catalyze DNA polymerization on undamaged templates.
dinB was constructed using the method described by Wanner et al Under normal circumstances, such prolonged access to the (Datsenko and Wanner, 2000) with primers FW2 (50acgcgttaaatgctg fork would be detrimental, but during the unique stress of HU aatctttacgcatttctcaaacc30) and RW2 (50gtgatattgaccgatttttcagcgagaatt treatment (low dNTPs), it is advantageous for survival, albeit cgatgcat30). The deletion was transduced by P1 (Miller, 1974) intothe appropriate strains from BW25113 (Datsenko and Wanner, at a mutagenic penalty.
2000). P1 transduction was also used to transfer the umuC122 allele Why does this apparent failure to hand off to the replica- (Elledge and Walker, 1983), a deletion of the umuDC operon tive polymerase in the umuC mutants prevent HU-induced (Woodgate, 1992), and a precise deletion of umuC. Wild-type and death? Although it is possible that UmuC communicates umuC122 thyA derivatives were constructed by P1 transductionfrom the strain EGSC#6827. The dinB003 allele (Wagner et al, 1999) directly with either or both of the mazEF and relBE gene was constructed on the chromosome of BW25113 using the plasmid- products, thereby signaling cell death in response to stalled borne allele as a template. The umuDC-containing plasmids are replication forks, it is perhaps more likely that the prolonged derivatives of pGB2 (Sutton and Walker, 2001b). The noncleavable action of the UmuC derivatives at the replication fork pre- UmuD(S60A) allele (Nohmi et al, 1988) was introduced by site-directed mutagenesis using a Quickchange kit (Stratagene, La Jolla, vents the generation of an intermediate that would lead to the CA) with the following oligonucleotide (50gcaagtggtgatgctatgattga mazEF- and relBE-dependent process of cell death and lysis.
tggtgg30) and its reverse complement. The umuC122 allele was We suggest a factor that responds to one of these intermedi- reconstructed in the same plasmid system using the primer ates that is specific to thymineless death is missing in the P90C strain, explaining why the umuC122 derivative behaves Strains were grown routinely in liquid or solid media (LB) or in as the wild type upon Tp challenge. The carboxy-terminus of minimal M9 medium with the addition of HU (30–100 mM), UmuC harbors interaction sites for both UmuD ampicillin (Amp; 100 mg/ml), spectinomycin (Sp; 60 mg/ml), chlor- (Jonczyk and Nowicka, 1996; Sutton and Walker, 2001b), amphenicol (Cm; 10–20 mg/ml), kanamycin (Kan; 50 mg/ml),rifampicin (Rif; 100 mg/ml), trimethoprim (Tp; 3–7 mg/ml), diamino- which are absent in the UmuC122 protein. Perhaps, the lack pimelic acid (DAP; 30 mg/ml) and thymine (Thy; 50 mg/ml) of this domain alters the ability of the UmuC122 protein to whenever required. The dinB þ locus was reconstructed on the return the primer terminus to the replicative DNA poly- chromosome using the same approach as the dinB003 construction merase. Moreover, the data in Figures 3B and C highlight the in the CmS derivative of umuC122DdinB mutant. The locus wastransduced with P1 phage, and the presence of the full-length role of UmuD cleavage in HUR. Alternatively, the truncated dinB þ gene was verified by PCR with the primers dinBF, UmuC122 protein may remain at the replication fork due to 50atgcgtaaaatcattcatgtgga30 and dinBR, 50tcataatcccagcaccagttgt30.
altered interaction with the b-subunit of Pol III as deletion ofits C-terminus may modify the accessibility of its b-binding HU treatment
motif (residues 357–361) (Becherel et al, 2002). It is clear that Cultures were routinely treated in LB broth containing HU(Calbiochem) by diluting saturated cultures 1:1000. Treatment of umuC122 and DumuC are both loss of function alleles for UV- ca. 106 bacteria/ml was for 6 h or as noted in the text or figure and chemical-induced mutagenesis in exponentially growing legends. Viability was checked throughout treatment. For anaerobic 876 The EMBO Journal VOL 25 NO 4 2006
& 2006 European Molecular Biology Organization Replication fork stalling and Y-family polymerases Table I Strains and plasmids used in this study Bacterial strains D(lac-pro)XIII thi ara Cairns and Foster(1991) P90C umuC122::Tn5 As P90C, but with Tn5 insertion in the umuC gene As P90C, but bearing a precise deletion of the dinB gene and replacement by cat As P90C, but bearing a deletion of the umuC gene As P90C, but bearing a deletion of the umuDC genes and replacement by cat P90C umuC122DdinB As P90C umuC122, but bearing a precise deletion of dinB gene and replacement by cat P90C umuC122dinB003 As P90C umuC122, but with dinB003 encoding DinB D103N P90C umuC122dinB+ As P90C umuC122, but with cat upstream of dinB As P90CDdinB, but bearing a deletion in the umuDC genes As P90C, but with a deletion in the thyA gene linked to Tn10 P90C umuC122::Tn5 thyA As P90C umuC122::Tn5, but with a deletion in the thyA gene linked to Tn10 As P90C, but with a deletion of the relBE genes and replacement by a KanR marker As P90C, but with a deletion of the mazEF genes and replacement by a KanR marker F thr-1 leuB6 proA2 his4 thi1 argE3 lacY1 galK2 rpsL supE44 ara-14 xyl-15 mtl-1, txs-33 AB1157 umuC122::Tn5 As AB1157, but bearing a Tn5 insertion in the umuC gene This work, WalkerLab Stock F+ dapA zde-264::Tn10 As HM21, but bearing a deletion of the relBE genes and replacement by a KanR marker As HM21, but bearing a deletion of the mazEF genes and replacement by a KanR marker HM21 umuC122::Tn5 As HM21, but carrying a Tn5 insertion in umuC gene araD139 D(argF-lac)205 flb-5301 pstF25 rpsL150 deoC1 H Engelberg-Kulka MC4100 relA+ DmazEF As MC4100, but bearing a deletion of the mazEF genes and replacement by a KanR H Engelberg-Kulka pSC101 derivative, bearing an SpR marker As pGB2 bearing the umuDC genes As pDC, but the umuC gene carries a A39V mutation As pDC125, but the umuD gene encodes only the 24 aa shorter protein UmuD0 As pDC, but carrying a truncation in the umuC gene As pDC122, but the umuD gene encodes only for the 24 aa shorter protein UmuD0 As pDC, but carrying a D104N mutation in the umuC gene As pDC, but carrying a truncation in the umuC gene and a D104N mutation As pDC, but carrying an S60A mutation in the umuD gene As pDC125, but carrying a S60A mutation in the umuD gene treatment with HU, cultures were treated as above for 6 h with 55 mM HU in an anaerobic chamber (Coy Laboratory Products)with a mixture of 5% carbon dioxide, 10% hydrogen, and 85% We would like to thank Sue Lovett (Brandeis) for providing us with nitrogen. Samples for Western blotting were either TCA precipitated the DumuC mutant strain, Hannah Engelberg-Kulka (Hebrew (20%) or concentrated 100-fold. The aUmuC antibody was used at a University) for the mazEF strains, Kim Lewis (Northeastern dilution of 1:20 000. The secondary antibody dilution and further University) for the HM21 mazEF and relBE strains, and the E. coli detection were performed following the manufacturer's instructions genetic stock center for the #6827 strain. We also thank JoAnne Stubbe (MIT) for the antibodies to RNR subunits, Alan Grossman For the thymidine incorporation during HU treatment (100 mM), (MIT) for use of the microscope, and Michael Malamy (Tufts we used a 1:1 mixture of M9 medium (Miller, 1974) with 0.3% Medical School) for use of the anaerobic chamber. LAS was casein to LB with 10 mg/ml of thymidine. The 3H-Thy (Perkin- supported in part by a postdoctoral fellowship from NCI. This Elmer) incorporation was carried out in 10 min pulses, after which work was supported with the NIH Grant No. CA21615-27. GCW is the sample was immediately TCA precipitated (10% final).
an American Cancer Society Research Professor.
Ahmad SI, Kirk SH, Eisenstark A (1998) Thymine metabolism Battista JR, Ohta T, Nohmi T, Sun W, Walker GC (1990) Dominant and thymineless death in prokaryotes and eukaryotes. Annu negative umuD mutations decreasing RecA-mediated cleavage Rev Microbiol 52: 591–625 suggest roles for intact UmuD in modulation of SOS mutagenesis.
Aizenman E, Engelberg-Kulka H, Glaser G (1996) An Escheri- Proc Natl Acad Sci USA 87: 7190–7194 chia coli chromosomal ‘addiction module' regulated by guano- Becherel OJ, Fuchs RP, Wagner J (2002) Pivotal role of the beta- sine [corrected] 30,50-bispyrophosphate: a model for progra- clamp in translesion DNA synthesis and mutagenesis in E. coli mmed bacterial cell death. Proc Natl Acad Sci USA 93: cells. DNA Repair (Amsterdam) 1: 703–708 Bell SP, Dutta A (2002) DNA replication in eukaryotic cells. Annu Bachmann JB (1987) Escherichia coli and Salmonella typhimurium.
Rev Biochem 71: 333–374 Cellular and Molecular Biology. Washington, DC: American Boudsocq F, Ling H, Yang W, Woodgate R (2002) Structure-based Society for Microbiology interpretation of missense mutations in Y-family DNA poly- Bates H, Bridges BA, Woodgate R (1991) Mutagenic DNA repair merases and their implications for polymerase function and in Escherichia coli, XX. Overproduction of UmuD0 protein results lesion bypass. DNA Repair (Amsterdam) 1: 343–358 in suppression of the umuC36 mutation in excision defective Boye E, Stokke T, Kleckner N, Skarstad K (1996) Coordina- bacteria. Mutat Res 250: 99–204 ting DNA replication initiation with cell growth: differential & 2006 European Molecular Biology Organization VOL 25 NO 4 2006 877
Replication fork stalling and Y-family polymerasesVG Godoy et al roles for DnaA and SeqA proteins. Proc Natl Acad Sci USA 93: Marsh L, Nohmi T, Hinton S, Walker GC (1991) New muta- tions in cloned Escherichia coli umuDC genes: novel pheno- Broughton BC, Cordonnier A, Kleijer WJ, Jaspers NG, Fawcett H, types of strains carrying a umuC125 plasmid. Mutat Res 250: Raams A, Garritsen VH, Stary A, Avril MF, Boudsocq F, Masutani C, Hanaoka F, Fuchs RP, Sarasin A, Lehmann AR (2002) Marsh L, Walker GC (1985) Cold sensitivity induced by overproduc- Molecular analysis of mutations in DNA polymerase eta in tion of UmuDC in Escherichia coli. J Bacteriol 162: 155–161 xeroderma pigmentosum-variant patients. Proc Natl Acad Sci Masutani C, Kusumoto R, Yamada A, Dohmae N, Yokoi M, Yuasa M, USA 99: 815–820 Araki M, Iwai S, Takio K, Hanaoka F (1999) The XPV (xeroderma Burckhardt SE, Woodgate R, Scheuermann RH, Echols H (1988) pigmentosum variant) gene encodes human DNA polymerase UmuD mutagenesis protein of Escherichia coli: overproduction, eta. Nature 399: 700–704 purification, and cleavage by RecA. Proc Natl Acad Sci USA 85: Mathews CK, Sinha NK (1982) Are DNA precursors concentrated at replication sites? Proc Natl Acad Sci USA 79: 302–306 Cairns J, Foster PL (1991) Adaptive reversion of a frameshift McLenigan M, Peat TS, Frank EG, McDonald JP, Gonzalez M, mutation in Escherichia coli. Genetics 128: 695–701 Levine AS, Hendrickson WA, Woodgate R (1998) Novel Christensen JR, LeClerc JE, Tata PV, Christensen RB, Lawrence CW Escherichia coli umuD0 mutants: structure–function insights into (1988) UmuC function is not essential for the production of all SOS mutagenesis. J Bacteriol 180: 4658–4666 targeted lacI mutations induced by ultraviolet light. J Mol Biol Miller JH (1974) Experiments in Molecular Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Datsenko KA, Wanner BL (2000) One-step inactivation of chromo- Moyed HS, Bertrand KP (1983) hipA, a newly recognized somal genes in Escherichia coli K-12 using PCR products. Proc gene of Escherichia coli K-12 that affects frequency of persis- Natl Acad Sci USA 97: 6640–6645 tence after inhibition of murine synthesis. J Bacteriol 155: Elledge SJ (1996) Cell cycle checkpoints: preventing an identity crisis. Science 274: 1664–1672 Mun BJ, Mathews CK (1991) Cell cycle-dependent variations in Elledge SJ, Walker GC (1983) Proteins required for ultraviolet light deoxyribonucleotide metabolism among Chinese hamster cell and chemical mutagenesis. Identification of the products of the lines bearing the Thy mutator phenotype. Mol Cell Biol 11: umuC locus of Escherichia coli. J Mol Biol 164: 175–192 Fontecave M, Eliasson R, Reichard P (1989) Oxygen-sensitive Napolitano R, Janel-Bintz R, Wagner J, Fuchs RP (2000) All three ribonucleoside triphosphate reductase is present in anaerobic SOS-inducible DNA polymerases (Pol II, Pol IV and Pol V) are Escherichia coli. Proc Natl Acad Sci USA 86: 2147–2151 involved in induced mutagenesis. EMBO J 19: 6259–6265 Foti JJ, Schienda J, Sutera Jr VA, Lovett ST (2005) A bacterial G Nohmi T, Battista JR, Dodson LA, Walker GC (1988) RecA-mediated protein-mediated response to replication arrest. Mol Cell 17: cleavage activates UmuD for mutagenesis: mechanistic relation- ship between transcriptional derepression and posttranslational Frank EG, Ennis DG, Gonzalez M, Levine AS, Woodgate R (1996) activation. Proc Natl Acad Sci USA 85: 1816–1820 Regulation of SOS mutagenesis by proteolysis. Proc Natl Acad Sci Ohmori H, Friedberg EC, Fuchs RP, Goodman MF, Hanaoka F, USA 93: 10291–10296 Hinkle D, Kunkel TA, Lawrence CW, Livneh Z, Nohmi T, Friedberg EC, Wagner R, Radman M (2002) Specialized DNA Prakash L, Prakash S, Todo T, Walker GC, Wang Z, Woodgate R polymerases, cellular survival, and the genesis of mutations.
(2001) The Y-family of DNA polymerases. Mol Cell 8: 7–8 Science 296: 1627–1630 Opperman T, Murli S, Smith BT, Walker GC (1999) A model for a Gerdes K, Christensen SK, Lobner-Olesen A (2005) Prokar- umuDC-dependent prokaryotic DNA damage checkpoint. Proc yotic toxin–antitoxin stress response loci. Nat Rev Microbiol 3: Natl Acad Sci USA 96: 9218–9223 Pedersen K, Christensen SK, Gerdes K (2002) Rapid induction and Goodman MF (2002) Error-prone repair DNA polymerases in pro- reversal of a bacteriostatic condition by controlled expression of karyotes and eukaryotes. Annu Rev Biochem 71: 17–50 toxins and antitoxins. Mol Microbiol 45: 501–510 Hartwell LH, Kastan MB (1994) Cell cycle control and cancer.
Roy B, Guittet O, Beuneu C, Lemaire G, Lepoivre M (2004) Science 266: 1821–1828 Depletion of deoxyribonucleoside triphosphate pools in tumor Ji JP, Mathews CK (1991) Analysis of mutagenesis induced by cells by nitric oxide. Free Radic Biol Med 36: 507–516 a thermolabile T4 phage deoxycytidylate hydroxymethylase Sargent RG, Mathews CK (1987) Imbalanced deoxyribonucleoside suggests localized deoxyribonucleotide pool imbalance. Mol triphosphate pools and spontaneous mutation rates determined Gen Genet 226: 257–264 during dCMP deaminase-defective bacteriophage T4 infections.
Jonczyk P, Nowicka A (1996) Specific in vivo protein–protein J Biol Chem 262: 5546–5553 interactions between Escherichia coli SOS mutagenesis proteins.
Sargentini NJ, Smith KC (1984) umuC-dependent and umuC-inde- J Bacteriol 178: 2580–2585 pendent gamma- and UV-radiation mutagenesis in Escherichia Kai M, Wang TS (2003a) Checkpoint activation regulates mutagenic coli. Mutat Res 128: 1–9 translesion synthesis. Genes Dev 17: 64–76 Sat B, Reches M, Engelberg-Kulka H (2003) The Escherichia coli Kai M, Wang TS (2003b) Checkpoint responses to replication mazEF suicide module mediates thymineless death. J Bacteriol stalling: inducing tolerance and preventing mutagenesis. Mutat Shinagawa H, Iwasaki H, Kato T, Nakata A (1988) RecA protein- Kim SR, Matsui K, Yamada M, Gruz P, Nohmi T (2001) Roles of dependent cleavage of UmuD protein and SOS mutagenesis. Proc chromosomal and episomal dinB genes encoding DNA pol IV in Natl Acad Sci USA 85: 1806–1810 targeted and untargeted mutagenesis in Escherichia coli. Mol Sinha NK, Snustad DP (1972) Mechanism of inhibition of deoxy- Genet Genomics 266: 207–215 ribonucleic acid synthesis in Escherichia coli by hydroxyurea.
Koc A, Wheeler LJ, Mathews CK, Merrill GF (2004) Hydroxyurea J Bacteriol 112: 1321–1324 arrests DNA replication by a mechanism that preserves basal Sneeden J, Loeb L (2004) Mutations in the R2 subunit of ribonu- dNTP pools. J Biol Chem 279: 223–230 cleotide reductase that confer resistance to hydroxyurea. J Biol Koch WH, Ennis DG, Levine AS, Woodgate R (1992) Escherichia coli Chem 279: 40723–40728 umuDC mutants: DNA sequence alterations and UmuD cleavage.
Sogo JM, Lopes M, Foiani M (2002) Fork reversal and ssDNA Mol Gen Genet 233: 443–448 accumulation at stalled replication forks owing to checkpoint Kornberg A, Baker TA (1991) DNA Replication. New York: WH defects. Science 297: 599–602 Freeman & Company Sommer S, Becherel OJ, Coste G, Bailone A, Fuchs RP (2003) Lopes M, Cotta-Ramusino C, Liberi G, Foiani M (2003) Branch Altered translesion synthesis in E. coli Pol V mutants selected migrating sister chromatid junctions form at replication origins for increased recombination inhibition. DNA Repair (Amsterdam) through Rad51/Rad52-independent mechanisms. Mol Cell 12: Stubbe J (2003) Di-iron-tyrosyl radical ribonucleotide reductases.
Lopes M, Cotta-Ramusino C, Pellicioli A, Liberi G, Plevani P, Muzi- Curr Opin Chem Biol 7: 183–188 Falconi M, Newlon CS, Foiani M (2001) The DNA replication Sutton MD, Smith BT, Godoy VG, Walker GC (2000) The SOS checkpoint response stabilizes stalled replication forks. Nature response: recent insights into umuDC-dependent mutagenesis and DNA damage tolerance. Annu Rev Genet 34: 479–497 878 The EMBO Journal VOL 25 NO 4 2006
& 2006 European Molecular Biology Organization Replication fork stalling and Y-family polymerases Sutton MD, Walker GC (2001a) Managing DNA polymerases: Wagner J, Nohmi T (2000) Escherichia coli DNA polymerase IV coordinating DNA replication, DNA repair, and DNA recombina- mutator activity: genetic requirements and mutational specificity.
tion. Proc Natl Acad Sci USA 98: 8342–8349 J Bacteriol 182: 4587–4595 Sutton MD, Walker GC (2001b) umuDC-mediated cold sensitivity is Washington MT, Johnson RE, Prakash L, Prakash S (2001) Accuracy a manifestation of functions of the UmuD(2)C complex involved of lesion bypass by yeast and human DNA polymerase eta. Proc in a DNA damage checkpoint control. J Bacteriol 183: 1215–1224 Natl Acad Sci USA 98: 8355–8360 Tang M, Pham P, Shen X, Taylor JS, O'Donnell M, Woodgate R, Woodgate R (1992) Construction of a umuDC operon substitution Goodman MF (2000) Roles of E. coli DNA polymerases IV and V mutation in Escherichia coli. Mutat Res 281: 221–225 in lesion-targeted and untargeted SOS mutagenesis. Nature 404: Woodgate R, Ennis DG (1991) Levels of chromosomally encoded Umu proteins and requirements for in vivo UmuD cleavage. Mol Tercero JA, Longhese MP, Diffley JF (2003) A central role for DNA Gen Genet 229: 10–16 replication forks in checkpoint activation and response. Mol Cell Woodgate R, Rajagopalan M, Lu C, Echols H (1989) UmuC mutagenesis protein of Escherichia coli: purification and inter- Wagner J, Fujii S, Gruz P, Nohmi T, Fuchs RP (2000) The beta clamp action with UmuD and UmuD0. Proc Natl Acad Sci USA 86: targets DNA polymerase IV to DNA and strongly increases its processivity. EMBO Rep 1: 484–488 Zhang X, Lu Q, Inouye M, Mathews CK (1996) Effects of T4 phage Wagner J, Gruz P, Kim SR, Yamada M, Matsui K, Fuchs RP, Nohmi T infection and anaerobiosis upon nucleotide pools and mutagen- (1999) The dinB gene encodes a novel E. coli DNA polymerase, esis in nucleoside diphosphokinase-defective Escherichia coli DNA pol IV, involved in mutagenesis. Mol Cell 4: 281–286 strains. J Bacteriol 178: 4115–4121 & 2006 European Molecular Biology Organization VOL 25 NO 4 2006 879

Source: http://nuweb9.neu.edu/mutation/wp-content/uploads/C122_Godoy.pdf